Busch Lab

ZMP

arhgap44

Ensembl ID:
ENSDARG00000010433
Human Orthologue:
ARHGAP44
Human Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Mouse Orthologue:
AU040829
Mouse Description:
expressed sequence AU040829 Gene [Source:MGI Symbol;Acc:MGI:2144423]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1827 Nonsense Available for shipment Available now
sa6916 Nonsense Mutation detected in F1 DNA Not yet available
sa12914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1827
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 110 984 5 21
Genomic Location (Zv9):
Chromosome 3 (position 49868041)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44562461
GRCz11 3 48707872
KASP Assay ID:
554-1819.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTTTCTGCAGCAAGATGCTGAAGCTCTGTGGAGATACAGAGGAGAAGT[T/A]GGCCCAAGAGCTGCTCGTCTTTGAGCTTCAGATTGAAAGAGATGTCGTGG
Long Flanking Sequence:
GATTCCAGCTGAAGTGGGCGGATTGTGAGACGTTTGATTCGGGGGCGTTTTAGGGGTGTGGTTTGCGAGCTACTAGCCCGACAGTGGAAACGCAACATAATTAGGGCCTTACTACTCAACCTTCTGGGCGATTGGCCTTGCCCAATAAAAGCCCTGGCTCGTACTGAGCCTACAGTGGAAATGCGGCTGTTTGGTCCAGACCAAATGCAGCAAACTACAGATGTTAAAGCACCCTAATATAAGTTAGATCAAAAAGCAAAACTCTTTTTATTATAAATTTTATGCTTATGGCTTTGTAATGTTGTAAAAAACACTACTTATGACTTTGTTTATTTTGCTATGAGTGGCATTTTCTGCTCACATATAAGGGATTTTCTGAGATTCACAATAAGATACTAGGATGCAGCTTTGAATACGTCAAGGTCAAATTAGTTTCAGGGTCTGTTTTGACTCTTTCTGCAGCAAGATGCTGAAGCTCTGTGGAGATACAGAGGAGAAGT[T/A]GGCCCAAGAGCTGCTCGTCTTTGAGCTTCAGATTGAAAGAGATGTCGTGGAGCCTCTTTATGTGCTGGCTGAGGTGAGCGTTTATTTCCCTGTCAGTGTTATTCTATCATTTCAGCTGTACGAAAGTTGTCAAATGTATCAACTTTGTTACCAATAAGTACTAAAATGTAAAAAAAAAAAAAAAAAAAACATTCATTTCTCACAAACATTTGATTGATGATGAGTGGATTACCCAACACTGGCCATTGTGCTCACACACTCAACAGATATGAATGTGATTGGCTACAATGATCATCACTTGATGCTCTTCACCATGTTCTTACACATATACACAGACACTAGAGCATTTAAATGTCACTTCTAAACGATTACATCCATGAATAGATATCAGCGATCCACTGATCAATTAGATAAATGCAACTTTTAAACACTGAATGTTGTCCATACATCTGTGTAAGCACTTGGTGGAGAGTTTGAAGAGAGGATTTGTCACCATTCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3467
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 369 984 13 21
Genomic Location (Zv9):
Chromosome 3 (position 49851554)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44545974
GRCz11 3 48691385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTCTTTCCTCTAGTATTCAGGAYATGGACAAAAGGCTTCAAGCCCTGT[T/A]GTGTACATGTGAGAAACTACCAGCAGACAATCTGAACAACTTCAGGTATG
Long Flanking Sequence:
CTGAAAATTCTTACATAAAGCTGTGTGTTAAATTATTCATTAGTTTAAATCAATTCAAAGTTAAATAGTCAAATAATCATATTTCATAAAAACAATGAGAAACAGCATGATGAGGAAAGGATAAACGTTGATTCATGCTGAGATGAATTTGGAAGGTATAAATCTGAATCCTTCAGTATGATTTTAAAAAGGAGTGGTGTCCCAATCCCCAACCCAAACATAAGTACTGTATGTCTATGAGCAAGACTGTTGTCATTTCATATGAATGGTTGATAGCCAGCATCTGAGCCAACTAACAGGTCCAGGCAACACTTGGATGGTAGATAACAGCTTAACTAGCAGTTGTAGCAGGCCCCTTCTTGCCCATATGGACTGATAACTACTGATAACAACACATTCAATCAAGTGATTGAACCGAAGCAGGTAAATATCCATGCTTTACGTCTGTCCTTGTCTTTCCTCTAGTATTCAGGATATGGACAAAAGGCTTCAAGCCCTGT[T/A]GTGTACATGTGAGAAACTACCAGCAGACAATCTGAACAACTTCAGGTATGCCTGTTATTTACTCATTATTTGTTCATTTTAAGGAGTTGTTTGTCTTTGAGTGAGTCATGAATGCGGAGCTCATTAGCAAAGAAGAGTGTCAGATCTCTTTCACAGTACTTCCTTCACTGACAGCAAGTGGGCACATTTCTGAATTTTCAGAGTTCATTAGTCCTAAAAAGAATAGTTTGGAGTTTGGAAATTCCAGCTATACAGACACTATCTCTGTCAAAGAAAAAGTCAGCCTTTTTAATTTTCCTCTCATTTAGCCAAAAGGCTAAGGAAGCTCTTTTTCTAGCTCCTAATTAAAATGCTCCCACCAAAATGGGTTTACATCAAAAACACTATAATTTTTTTATGGGCTGCGTTAACACGAGACTTTTTTTCGGGCGATAAAAAAAACACTTTAATCCATTCTTAAAGTTGGGTTGGGAGCTGGGTCTATTCTAAGCAAGCTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6916
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 385 984 14 21
Genomic Location (Zv9):
Chromosome 3 (position 49850363)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44544783
GRCz11 3 48690194
KASP Assay ID:
554-5237.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGAAACTGAAAGTTTTTTTTTTTCTCTCTCTCTCTTCCGAAACAGATA[T/G]TTAATCAAATTCTTATCCAAACTCACAGAGTACCAAGACTCTAATAAAAT
Long Flanking Sequence:
TATGCATTTGAGTAAAACATATACAAATTAGATAAAGTGTGTGCTTTTTAAAATGAATGACGATGAATGAAAGTCCGGTGAGCATTCTGACAAAAAAATGCCCTTCTGAATCAAATCAGCAGGATGCCCTTCTTTATCTTTACTTACTTCAAAAACACTACTGACTACGTTTACATGGACATCAGTAATCTAGTTATTTGCCTTTATAGACAATAATATAATTTAGTATACTGTATATGTGTTTGTAAAACTACATATACAGTATATTTGGACATGTTTTTATTTGGCTCACATGACGAGGTTTCCAGATATAGGCTGTGGGTCTTGGCTTGGTTTGTTTGCACCTGGCTTGGCTTAGAAACCTACTGAAATATTGATCATAGACAGCGACAGGAATAGCAGATGTAAGCGTGAACGCCAGTGCTAAAAAGATGCTTTGTCAAAACTGAGACTGAAACTGAAAGTTTTTTTTTTTCTCTCTCTCTCTTCCGAAACAGATA[T/G]TTAATCAAATTCTTATCCAAACTCACAGAGTACCAAGACTCTAATAAAATGACACCAGGCAACATTGCAATAGTTCTCGGACCCAACCTGCTGTGGACACATTCAGAAGGGTGAGCGCATGTCCTCAGTTCTTGTATTTGTGAAAAGCAGCAAATTCACACAGCAATTTTAAGAGAAAAAGTGAAAAACCTACTTTCAGAAGACTTGTGGTTATATAAATTTATTACTGCTTTTCCTTTGTGGACCACATTTTTGCCATTGTTAACCATTTTTAATCAAGTTTTTTTGATGTATTAATTTAATTGACATTAGATAGTAACTGAGGTGAAATAGGTTTGTTGAATTATAAATTTTCTTTATAAAATTGCTTCAAGACTTCCTATCTTGTCTGACTTTGATCAGCAGAACTTTATTATATTTTACTCTAGATGTTTTTGGTTGGAAACCGAAAAGTTTGTAGTGTTTATACATGGCAACATGTAAACAAATGGTAGTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12914
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Essential Splice Site 452 984 15 21
Genomic Location (Zv9):
Chromosome 3 (position 49847268)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44541688
GRCz11 3 48687099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAATCATTGAGCCGATCATCCAGCACGCGGACTGGTTCTTCCCTGGAG[G/T]TTGGGACACAAAGAGTTGTGAAAACATATTCGCACATACAGGCGGGKGTT
Long Flanking Sequence:
GGCCAGTTAGTGTATAAGTTTAATTATTTTCAGCTTTTTTACTTTATTTGCATACTTTTAATGGTGCAGAACTTGTTCCCCACAGTATCAAAAATAGTATAGAATATTAATTTCGAAGCTGGAAAGTCCAGAATCATGACAACACTATTGGGTAGGATTAGTAATGTAAAATACAATCATACTTAAGTGCAAGTAAACAGTTTATATTCTTATTATAGGTAGGTAATGAGTCAGAAGTAAATTATGTGAATTGTTACTTTTTATCTTGTATATCTTATACCATACTATACCTTTAAATCAGCATATCTGAATGACATTTTTGGTGAACTGTTTCTTTTAAAACCTCCAGTAGTTTTAAGTTTTTGCTTTGTGGAATGAGTAGCTCCAACGGGTCATTGATCTCCACAGGAACATGACAGAAATGATGACCACCATGTCCCTGCAAATCGTAGGAATCATTGAGCCGATCATCCAGCACGCGGACTGGTTCTTCCCTGGAG[G/T]TTGGGACACAAAGAGTTGTGAAAACATATTCGCACATACAGGCGGGTGTTTTTCCCCGGTGAGAATTGAACTAATTTGTCTTTGCTATTCTTAGAAATTGAGTTCAACCTGACAGGCAGCTACGGCAGCCCAGTGCACACCAACCACAACTCCAACTACAGCTCCATGCCCTCACCAGATATGGACCAATCAGAGCGCAAGCAGCAGCACGACCAGAGCCGACGCCCACTCAGCGTTGCCACCGACAACATGATGCTGGAGTTCTACAAGAAGGACGGGTAGGTTGCTCTGCCTCACTGCTTTCCTCTGCCATGCACTGACATCACCATCCCATGCCACCCTCACTTCTTAAAGGGATAGTTCACCGCAAAATAAAATAAACGTCATCATTTAAAAATCATCTACTTGTCACAAACAGGTTTAAGTTTCTTCTGACAAATGCAAAAGAAGATGTTTTGAAGAATGCTGAGTCATTTCTTTTTGTATTGTATTTTTCTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5225
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 826 984 20 21
Genomic Location (Zv9):
Chromosome 3 (position 49799178)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44493598
GRCz11 3 48639009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGGCCCCTGTGCCGCCCAAGGTTCCCTACGGCCAGTCGGGGGGGATGT[C/A]AGACCAATCCACAGGTCAGCCGTCTCCGGTTAGCCTGTCCCCCACTCCCC
Long Flanking Sequence:
CCAGAGGTGTAGTTGCAAGTGTACAAGTTTGCGACGCAGTTTGCGAATGTTTGTTGAAGCGTCAGATTTGGGAAACATTAAATCCATGATCTAAGTTTGAAACGACAGAACTTGTGACCTCAGTTGGCTAACTGTGGTTTTTGGAAATGTTCCCCTGGTTGGCAGTGTAACTTGGATTCATTCATTCTAAGCAAGTGATTTAGTCTGTGAAGTCACAATTAGTCACAATCAAAAATGAGACTCATTATTAATACCAGTTGGAAACAGAGCTTTAGAATCACTTCTGAAAAAAATTTATTAAATAAAAAACCCAAAACACATCTACCTTTTTTGTGTTTCGATCACCTGCAATGAATGTTAGAACAAGGTGTAAACAGAGTTGTTTAGAATTAAAGTTACTTGGATGCAACTTTGATTTTGTTTCCTCTCTCTCCCTGCAGTGTCTAAGAAATTGGCCCCTGTGCCGCCCAAGGTTCCCTACGGCCAGTCGGGGGGGATGT[C/A]AGACCAATCCACAGGTCAGCCGTCTCCGGTTAGCCTGTCCCCCACTCCCCCAAGTACCCCCTCCCCTTACGGTTTGGGCTGTCCCCCTGGACATGCGCCCACCTCTTCCCCTGGCCAGACCCCATTAGGGGGACCCCATACACTGTCCTCACCACCAACTTCTCTGACTGGTACGCTCACAAAGTCCCGGCCCAACCCAAAGCCCAGGCAGAGACCCAGTCTGCCCCCTCCCCAGCCGCCCACCGTGCCCCCTACGGTCCCCCAGCCCCTGGAGCAGGGTCTACTTGACGGATTATCCCCCGGAGAGAGCATGTCCACAGGTAAACATGCCTCAGTGGCACCATCACGATTGGGAGTCCAGCGTCCCTCTCTCAAACTGTCTGTCTCTCCGTCCTACGCAGGCGATGGACTTTAAGGAGCCAGATACCCCATGATATGTGATTTATTAAATAGGGGGAGCCCATAGATTGCCTTTGAGATGTATAATACTGTATGATAAT
Associated Phenotype:
Not determined