Busch Lab

ZMP

si:ch211-26b3.2

Ensembl ID:
ENSDARG00000010331
ZFIN ID:
ZDB-GENE-081104-212
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JL69]
Human Orthologue:
CXorf57
Human Description:
chromosome X open reading frame 57 [Source:HGNC Symbol;Acc:25486]
Mouse Orthologue:
D330045A20Rik
Mouse Description:
RIKEN cDNA D330045A20 gene Gene [Source:MGI Symbol;Acc:MGI:2147848]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20392 Nonsense Available for shipment Available now
sa33581 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20392
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080774 Nonsense 45 807 1 15
ENSDART00000131885 Nonsense 57 489 2 9
Genomic Location (Zv9):
Chromosome 5 (position 24620243)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22333115
GRCz11 5 22836915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCTCTGGACCGGTATCTGAGCTTTCAACATCCCGCAGCCCAGAGCTA[C/A]AGTTACGACCTGACGCTCACCGACGGCCGCTGGCGGATAAAGTGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33581
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080774 Essential Splice Site 321 807 4 15
ENSDART00000131885 Essential Splice Site 333 489 5 9
Genomic Location (Zv9):
Chromosome 5 (position 24622232)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22335104
GRCz11 5 22838904
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGGCCTCAGTGGGGTCTGCCTGAAGTTCCTTACAACTTTGCCACACGG[T/A]ATGCATAATCACTACTAACAAACATGTTTCTTTAATTCTTTGGTTTTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3563
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080774 Essential Splice Site 426 807 7 15
ENSDART00000131885 Essential Splice Site 438 489 8 9
Genomic Location (Zv9):
Chromosome 5 (position 24625327)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22338199
GRCz11 5 22841999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTCCGTGTATCTSACCAGTAGCACAGAGACACAGCTCTTCATTACAGG[T/C]AAGTTTCAGACAGCCAGTTMGATCACATACTGTATTCATTATCAGCTCAA
Associated Phenotype:
Not determined