Busch Lab

ZMP

qars

Ensembl ID:
ENSDARG00000010316
ZFIN ID:
ZDB-GENE-040426-1011
Description:
glutaminyl-tRNA synthetase [Source:RefSeq peptide;Acc:NP_957507]
Human Orthologue:
QARS
Human Description:
glutaminyl-tRNA synthetase [Source:HGNC Symbol;Acc:9751]
Mouse Orthologue:
Qars
Mouse Description:
glutaminyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1915851]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41293 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17949 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27269
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023780 Essential Splice Site 88 437 2 14
ENSDART00000060919 Essential Splice Site 88 774 2 23
ENSDART00000115253 Essential Splice Site 111 797 2 23
ENSDART00000136602 Essential Splice Site 88 224 2 7
ENSDART00000137472 Essential Splice Site 88 457 2 14
Genomic Location (Zv9):
Chromosome 8 (position 48539415)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46377673
GRCz11 8 46385552
KASP Assay ID:
2260-1087.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAATACATCATTTCACGAAAAATCACAACAGAACTGCAGCTGTCAGG[T/C]ATCTGATTTTGCTCCTCTGGAACTGTTCACCTTTTGTTTCTCAGTGTATG
Long Flanking Sequence:
GCCTTCTGCAGGCTTTGTAGAAGCGTAAAAACCGGCGTGTGTGGTGAAAGAGAAATGGCGGACGTGGTGTCTTCTTTCATGTCAATTGGCCTTAGTGAGCAGAAAGCTAAGGAAACGTTGAAGAATGAAACACTTTCATCAACACTCAAGAAAGCCATTGATCTGGTAACGTTACGTATTTGATTAGAATACATAACGAGTCGCTGATGTGGTTCGTTGTCAACGTCTTTAGCCTCTTGAAAACTTTCATTACAGTTTCTCTAATCACTTTATTTACAAAAACTAGTAACCAAATTAATCATAGATGATTAAACATGTTATTGCTTATGTTACTGTTGTGTTTATCAGGCTCAAGGCCAGCTGGGGTCTTCTGCCATTGACAAGATCACTGGCACTCTGCTGTACAGTATGGTGACACGACTTAAAGACACGAACAGGCTTCCCTTTCTCACAAAATACATCATTTCACGAAAAATCACAACAGAACTGCAGCTGTCAGG[T/C]ATCTGATTTTGCTCCTCTGGAACTGTTCACCTTTTGTTTCTCAGTGTATGTTGTGACTTAAAATATTGACTTTAAAGTACACATGAATATAACACTAAACATGGGTTTTGTTAACTCACATTGCTAGTTTTGTGGTGAATATCATTAAGACAAAAACATAGTTTGCTCTTATAAAGTTTAAATTGAAATCTAGAAATGCGATTCTAGTTTGATTACAGTTACATTTTCAGATTACATGTTTGAGGTATTGGGCGTGGCTAACGTACTTAACCACACCCCTCCAACTGTCAAGGCTGATTTATACTTCTGTGTCAAGCTTAGGCACATGGTCCGGCGCAGCCTTCACATGGCCACCTAAAGCCTGGTTTATACTTCTGCGTCAAGTGACCGGCGCAACTCACGGCGCAGGCAACACGCGCAGCTGTGCATTTATACTTCTGCGCGCTGTCTCCGTTGGTCTGCATTAACACTTCCGAAACGCTAGAGGGCAGTGAGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41293
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023780 Essential Splice Site 233 437 8 14
ENSDART00000060919 Essential Splice Site 233 774 8 23
ENSDART00000115253 Essential Splice Site 256 797 8 23
ENSDART00000136602 None None 224 None 7
ENSDART00000137472 Essential Splice Site 233 457 8 14
Genomic Location (Zv9):
Chromosome 8 (position 48530440)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46368698
GRCz11 8 46376577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATTGATGGAGCAGCTGAGAGGAGAAGCTCTTAAGTTCCATAAGCCAG[G/A]TAAGTGTCCTTAACGACTATGTGTCCAGATAGCTACAATGTCATTCAATC
Long Flanking Sequence:
GTGATATGATAAGTGAAAAGCTTAGGTGGTAGCTCCAGACAACATAATCCACAACAATATTATAATAACAGTTAAGTACAAAAAACAATAAATATGTTTTAAAAATTTTTTTATTTGTTATAATGTTGTATTGTATAAATTTAGTATTTGGTATAATGCCAAACCAACAATAATTTAAGCGTCATTATTTTTGTGAAAATTATATGCTGCATCAGAGATGCTAGTAATGGCTAGGGTTTGGCAGTATGATGATATATCTTTTGGCGGCAACAATATAAAGTTTCTTTTGATAGGTCATTTGCTGTATTGTAAATATATTGAACATCTGGTTCTAGAACTATACTTTAAAAGGAGATTCTTGAACCATCTAACATGATTTCTTCATAAAATTGTAAAAGTCTGTTTTACTAATGCATCTTTCTCTCAAGGTGATGGGAACATTGAGAATAAGTCATTGATGGAGCAGCTGAGAGGAGAAGCTCTTAAGTTCCATAAGCCAG[G/A]TAAGTGTCCTTAACGACTATGTGTCCAGATAGCTACAATGTCATTCAATCTTCTTATTTTTCCTTTTATCTTCTCGGCACAGGGGAGAATTACAAAACGGAGGGTTATGTTGTAACACCTAACACCATGAACTTGCTGAAGAAGCACTTGGAAGAAACTGGAGGACAGGTATGACTACAACTGCAACTACAAGGGAGCTAGCTGGAGCTCGTCTACCCCAATAAAGACATGGGCTCTCCTAAAAACATGATTTGTGAAATTTCTGGGGATCTCAAAAAATATTAACAATGTGTTACTGTATTGTGCAATTTCAGTTTCATATTATTCGTTCAGCGATTCATTTGTTCCCAAGTCCCTTCTTAGCGCGATGCTAATCTGCGCTGATTGGTCCAATGACCCAGTCTGTGATTGTACGACTGCGTTAAGCGCGAGACAGAAAAAAAGATCAACAATTTGTAATCAGAGTGCAGAGAGTATGTGTAAGCATACCTGCCAGAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27268
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023780 None None 437 None 14
ENSDART00000060919 Nonsense 529 774 16 23
ENSDART00000115253 Nonsense 552 797 16 23
ENSDART00000136602 None None 224 None 7
ENSDART00000137472 None None 457 None 14
Genomic Location (Zv9):
Chromosome 8 (position 48523824)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46362082
GRCz11 8 46369961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTAGGCTTTTTACCCTCACAGCTCTCAGGAGACGTGGGTTCCCTCCA[C/T]AAGCCATCAACAATTTCTGTGCCCGGGTGAGAATGTTTTTTATTGTCATA
Long Flanking Sequence:
TATATTATTTGTAAAAAGTCAAATTTGCTTTGTACATTGGGGAAAAATATACAAAGGGGGCTAATAATTCTGACTTGAACTGTAAAAGAAATATTTTGCCTATAAAAGCAAAATGAATTTAGAACATTGCAGTTGTGTTTTGTTTGTAAAATAATGTAAATAATGTCCTACATGCTGATTATTCTGTCTTTCTCAGACGATCATCATATTTCTGGTTGTGCAATGCTCTGGATGTGTATTGCCCGGTGCAGTGGGAATATGGCCGACTGAACCTCACTTATACTGTCGTTTCCAAGAGAAAGATCATCAAATTGGTGGAAACAGGAGTTGTTAGGTAGTACAAACACACTCATCTTATTTTATTTTTTGGGGGGGTCATTTATTGGTGTGATGGAAACACATATTTCATGCTGTATTGTTTGTTTGTTTTTTTTTTCAGAGATTGGGATGATCCTAGGCTTTTTACCCTCACAGCTCTCAGGAGACGTGGGTTCCCTCCA[C/T]AAGCCATCAACAATTTCTGTGCCCGGGTGAGAATGTTTTTTATTGTCATATTATCTTTCACCTGTTGCATTACTGCAACATCCCGCTTGTTAGTTTGACTAATTCGGATTTAATGGTACTAAAATGTCAAAAACCTTGAGTGTGTTTGTTTGTTTCAGTTGCCACACTGTAAAAAACATGACAAAAAGTCAAGATAATAAATATATATTCATAATATATAAATATAAATTTATGTAGCTATAACTTATTTTAATAAGTAAATTAGTTTTAAACTTAATCAGGTTTAAACTAAAAAATTAAGTCGGCAAGAATTTAGTTTTACAGTCCATTTGACATCCAGCAGAAAAGTCATTGTAAGAAGTCTATACTAAACGCATTACTGACACATTATTTTTGCTATTTGAATAATTAAAACTACATGTATACATGTTAAAGGAATAGTTAACCCCAAAAATCATCATTTACTCTCCCTTTACTTGTTTCAAACCTGCTTGAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17949
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023780 None None 437 None 14
ENSDART00000060919 Essential Splice Site 759 774 23 23
ENSDART00000115253 Essential Splice Site 782 797 23 23
ENSDART00000136602 None None 224 None 7
ENSDART00000137472 None None 457 None 14
Genomic Location (Zv9):
Chromosome 8 (position 48507330)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46345588
GRCz11 8 46353467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATTGAGTTTAACTTGTAWACTGTTTTTGYTTTGTTTTGTTCTYCA[G/A]CTGGTGTTCAACAGGACTGTTACACTCAAGGAGGATCCAGGAAAGATATG
Long Flanking Sequence:
ATGCTTTTATCCGATTAATTGGCCATCAAAATAATCGTTAGTTGAAACCCTGCTTGAATTGTTTACTTGCTACGTCACGCTCCGATTCGTTGTTGAATGAAGACCAATGCTTATAATATCCCAGCTTATTGACCTTATTCTAAAATGTGGAAGTGCGACTGTTTTCGCGATTGTCTTAGAACTTCCGATTCAGTCGCCTATGGGAGAAATGACTAGGGATAATAAACGGCAGAAAACGGTCAAACTACTTGCTCTACAAACAAATTTTTGCATGACTACACAGACCAAGTAGAATAATATAATAATAAAATATCAAATTGCAACATCAAGCAGCGTAACGAGCAGTTTTTAACGTCAAAAAATGAATGGAAGTGAATGAGACCAGAAGTCTCGAGCCAAAAAGATTCAAATGGCAGCGCCCGCTCATCGGCGGTGAATAAACAAATGAACATGACATTGAGTTTAACTTGTATACTGTTTTTGTTTTGTTTTGTTCTCCA[G/A]CTGGTGTTCAACAGGACTGTTACACTCAAGGAGGATCCAGGAAAGATATGATCAGACTTCAGGACAGAGACCGTACTTTGACTACATTTATGCATCACAAACCTGTCAATAAAATCTAATTAACCAGGGAATTCAGTATGTTTGTATTCAAACTCTCATTGTTATGACTGTCACATCCTGAGCTTACCTATGTGTAACCCATTCACTCTGCTGGGGTTTTGAAGTCCAATATTTAATTAAAATATTTTTACACTTGAAGTTCAAATGAGTGGAAACGATTTTTGGCCAGTTTCTAAAAGGGAAAATACATTCATATTTAAATGAATCTTTCTTGGATAATATAAAAACCTGTGGATAACCAGAGATTCACTTTAGTTTTCTACAGGTGAGTATGAAACAAAAATTGTGCAGGATGCGGGGGAAAGGACAGCTCGCCTCAAAGTAGATTCAGTCCTCATTTACATGGATTAAAGTTCTCCGTTGCTATAATAGACTGGAAA
Associated Phenotype:
Not determined