Busch Lab

ZMP

si:dkey-219c10.5

Ensembl ID:
ENSDARG00000010280
ZFIN ID:
ZDB-GENE-081104-520
Description:
CLIP-associating protein 1 [Source:RefSeq peptide;Acc:NP_001108611]
Human Orthologue:
CLASP1
Human Description:
cytoplasmic linker associated protein 1 [Source:HGNC Symbol;Acc:17088]
Mouse Orthologue:
Clasp1
Mouse Description:
CLIP associating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1923957]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15630 Nonsense Available for shipment Available now
sa41484 Nonsense Mutation detected in F1 DNA Not yet available
sa34705 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15630
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102445 Nonsense 14 1534 1 40
ENSDART00000131334 None None 126 None 5
ENSDART00000137955 Nonsense 14 1492 2 38
ENSDART00000142853 None None 63 None 3
Genomic Location (Zv9):
Chromosome 9 (position 39220360)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38358256
GRCz11 9 38168051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCRTAGRCCATGGAGCCCAATATGGAGTACTGTCTGACCCAGGTGCTA[C/T]AGAAGGATGTTGCRCGAAGGTTGCAGATGGGTCCGGAGCTCATCGACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41484
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102445 Nonsense 696 1534 21 40
ENSDART00000131334 None None 126 None 5
ENSDART00000137955 Nonsense 685 1492 21 38
ENSDART00000142853 None None 63 None 3
Genomic Location (Zv9):
Chromosome 9 (position 39308132)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38446028
GRCz11 9 38255823
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCCGGCAGCCGATCCAGTTCACCAGGGAAGCTTTTGGGACATGCGTA[T/A]GGCAGAATTCCTAGAGCCACTGCGCCAACAACTCCCTCAGACAAGTACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34705
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102445 Nonsense 1272 1534 34 40
ENSDART00000131334 None None 126 None 5
ENSDART00000137955 Nonsense 1217 1492 32 38
ENSDART00000142853 None None 63 None 3
Genomic Location (Zv9):
Chromosome 9 (position 39330607)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38468503
GRCz11 9 38278298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTCCAGAGAGTTTGCACCCTACGGCTATGGAGACACAATCACAGCCTA[T/A]GATAAAAGTGCCCTGAAAGAGGCCGTCTTTGATGACGATGTGGAGCAGTT
Associated Phenotype:
Not determined