Busch Lab

ZMP

dpyd

Ensembl ID:
ENSDARG00000010267
ZFIN ID:
ZDB-GENE-040426-2459
Description:
Dihydropyrimidine dehydrogenase [NADP+] [Source:UniProtKB/Swiss-Prot;Acc:Q6NYG8]
Human Orthologue:
DPYD
Human Description:
dihydropyrimidine dehydrogenase [Source:HGNC Symbol;Acc:3012]
Mouse Orthologue:
Dpyd
Mouse Description:
dihydropyrimidine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2139667]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa17210 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17210
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100133 Essential Splice Site 37 739 1 15
ENSDART00000124724 Essential Splice Site 270 974 7 21
Genomic Location (Zv9):
Chromosome 2 (position 18050390)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20361436
GRCz11 2 20019585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACACATCAAAGGATTTCCTTCCTTTGGTTGCAAAAGCCAGTAAAATAGG[T/A]ATTGAAGAAGAGAGACAAAATCCTTTCANNATGGKGCAATGTAAAAAAAA
Associated Phenotype:
Not determined