Busch Lab

ZMP

igf2bp3

Ensembl ID:
ENSDARG00000010266
ZFIN ID:
ZDB-GENE-000308-1
Description:
Insulin-like growth factor 2 mRNA-binding protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q9PW80]
Human Orthologue:
IGF2BP3
Human Description:
insulin-like growth factor 2 mRNA binding protein 3 [Source:HGNC Symbol;Acc:28868]
Mouse Orthologue:
Igf2bp3
Mouse Description:
insulin-like growth factor 2 mRNA binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1890359]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6552 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45668 Nonsense Mutation detected in F1 DNA Not yet available
sa36823 Nonsense Mutation detected in F1 DNA Not yet available
sa43262 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29190
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Essential Splice Site 79 582 2 15
ENSDART00000133633 Essential Splice Site 29 110 3 7
Genomic Location (Zv9):
Chromosome 19 (position 20685055)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20618435
GRCz11 19 20202758
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCACGGAAAAGTCTTAGAAGTGGAGCACTCTGTCCCTAAGCGACAAAG[G/A]TAAGATTCATGTGTAATTTATGCAATTTAATAAAAATGGCTGGATCCAGA
Long Flanking Sequence:
GGTGGCTTGTAGGCCTTTCGACTACTCCCCTCGTTTGCTCAATATGTACTCAATGTGTTTGGGATGAGTGTAAATTGTGTAAAGCCTGCTATATTTGCCATAAACAGACTGTCCACTAATTTATACATTCTCATTTTTGTTCTTAAAGTCAATGTCTCGCTGCTCGTGGCTAGGCCTTCGCTCAAGCGTGGGGGCAAATTTGTCTTCCATGTTTAACCTCTGGGAATTTTGTATCTATACTATTTTAATTAAACAGGTTTTACATTAGGATATTTTAAATATTTTTCTGACACCGTGAAGTGTGGTTTTATACACGTTACGTAAATGTGTTTTATATTTGTGTAGGCTACTTTCGTATATTTAAAGTCTATCACACAATAAACATTTTTTATTTAAATTATAATGTGATTTTACTGAATTATAATTAATATTTTTTCAGGAAAAGTAGAACTCCACGGAAAAGTCTTAGAAGTGGAGCACTCTGTCCCTAAGCGACAAAG[G/A]TAAGATTCATGTGTAATTTATGCAATTTAATAAAAATGGCTGGATCCAGACTTTTGCTTGGAATTATTATTTCTAAATATTTTTCACACAATAGACATGTATTTAAATCCCCAAAGACTCCTTTGATTTGATTTTCCTTCATATGGTCCATTAAAATCGTATGTGCAAGCGAAATGATGGTGGCGTCTGTTTTATGTAGGCTATCAGTATTAAATGCAGATCTGATGGCTTGTTTTAGTAACAAAAAAAGGTGTGCGAGCTCCTGATTGAACCTCAGTGCCAGCGTGTGGAATGTGGGTTTTTGTAATACATCTGAGGCTCTTGATGTACTAAATTCCCATATTTCTGGACATTTAGGCCCTGACAAAACGCAGCCAAGAAACGTAGCAGAGATGTGCAAAGTGAGAACGCAAACGTTGTAAATGGGACCGCACGTTGCACATGAATGTGCATTTATGGAGCCATGCTTGCTGTGGCGTCCATTTAAGAAGAAACTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6552
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Essential Splice Site 112 582 4 15
ENSDART00000133633 Essential Splice Site 62 110 5 7
Genomic Location (Zv9):
Chromosome 19 (position 20702340)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20635720
GRCz11 19 20220043
KASP Assay ID:
554-4598.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAGACGGGTTGTTAGCACAGTATGGCACAGTRGAAAGCTGTGAACAAG[G/A]TAAGATGYATTATTCAGCAAACARTCACTTGTATGGTAATTCAATTATTA
Long Flanking Sequence:
ACTGGTTCGAGCCCCGGCTAGGTCAGTTGGATGGAAATCCTTCATGTTCAATAATTCAATTTAGATTCAGTAAATCTTTTGCTCTAAATCTTTTTAACAATTCACCTTACTGTAAAGCACATTTTACTGGACTGTCCTGCTTTTAATGATTCCAGAAGACTTTTTTATAAAATTCATTCTTAAGAATTTTTTTTTAAGCAAAGTGACACCAGAAAAGATTTTAGAATTTTTATCAAGTATTAACACTAAAAATCTTATTTAATTTATGTATTCATTTGTCAGTTTTTAATTGTATATTTATTATTGTAATGTTCCTGCCATGAAAATAGCCTTGGTTACTGACATGGCATTAAATAGAAAATACACTACATTTAAATGTGTTTTTAGACCTCCACCAAAATCTTACACCAAAACAATCTAAAGTGTGTTGCTTTTTCTTCACCCGCAGGTTTTAGACGGGTTGTTAGCACAGTATGGCACAGTGGAAAGCTGTGAACAAG[G/A]TAAGATGCATTATTCAGCAAACAATCACTTGTATGGTAATTCAATTATTAAAAGATTGCTGAAATCTCGACCTCTGTCTGTCTTTTCTTCTCTTTTATCGTCAGTCAACACTGACACCGAGACAGCAGTCGTCAATGTGCGATATGGTGCCAAGGACCAAGCCAGAGAGTGAGTATCATCTGCCTCTCATTCGGTCACCACACCACCACCCCCTCTTCCAGCAACTTGCAGAGAAATGCGAGAGAGTCAGATCCACACACATACACTGCTATTTGGGTTTATTCAACAATTATAATAACTCATTCAGTGCCACCTACTGTTTGATTAGTAGAACTGCAAAGCGGTCTCGGGGGTTGCTGAAGAAGCCTCCGGTAAATGAATGGAGCCGCTTGGATAAAAGGATTTTCGGGCAATTGTTTGTTCACAATGGGAGTTCCTGTTAGCATCCACTAGTGGAGGTCAACCAGAGATTTGGTGGCGTATAAGGGCACTTGCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45668
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Nonsense 399 582 10 15
ENSDART00000133633 None None 110 None 7
Genomic Location (Zv9):
Chromosome 19 (position 20713543)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20646923
GRCz11 19 20231246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCACCCTCTGTGGTATCAGGACCACCGCCTGGGGCTCAAGCTGGATA[T/G]CAATCATTTGGGGTAATACAATTAGAAGGGAAAATGTGTTTGTGTGGGGA
Long Flanking Sequence:
TCTTCAGGTCCTAGCAGATATTGAACGTGAGAATTGTATACAATTTATTTTTTGGCATTATAAAGGGCATAATATTTACAGTAGTTTACTTTAACATGTATTGGCAATAACGTGTTTCTTTTATCCCTCTCTTTCTAAATTCCAGTCTGCAGGATCTGACCTTGTATAACCCAGAGCGCACCATTACTGTTAAAGGAACGTTAGATGCTTGTGCAAAAGCTGAAGAAGAAATCATGAAGAAAGTCCGCGAGTCCTATGAGAACGATGTAGCTGCCATGCACGTAAGTCTGCACAGCAATCTTTATTAATGTCTAAACTGGCATATAGGACAACTTAATGTTAAAAGAACTAAATTTCTGCCGTTTCTCTTTCCTCTAGCTTCAATCTAACCTGATTCCAGGGCTCAATCTGAATGCATTGGGTTTATTTCCTGGTGCAGCGAGTGGAGGGATTTCACCCTCTGTGGTATCAGGACCACCGCCTGGGGCTCAAGCTGGATA[T/G]CAATCATTTGGGGTAATACAATTAGAAGGGAAAATGTGTTTGTGTGGGGATGCATAATACCGTTTCTTTTTCTTTAGTTTTATTAATTTTTTTTATATAAATACAGTAAAAGAAGTTTATTTATTTATTTATTTTTTATTAATGCCAATATTTTTGCCAAATTCATTCGTTTTTTTTATTTCTTTTTTTAAACTATTAATATATACACTAATAATGCTTAATTTATTAGTAGAACTTTAAATATTTTGCTGTGCTAATATTTACACCCCTGAGTAAATACATTTTTTTCTATCTGGCAAGTACTTTGACAATGGTGGGGTGGTTGACTGACAGCTATTTTTTTGTTTGCTTAAAAAAAAAAATAACACTTATTTTTTATTTATTTATTTTTTAAAATTCTTTTTTAAGCCTGGTTTATACTTGCTGCATCGAATAATCTGTGTGACCCACGGTGCATGCCTTGTGTGTTGCTGTGCATTTATACCTCTGCTCTACAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36823
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Nonsense 547 582 14 15
ENSDART00000133633 None None 110 None 7
Genomic Location (Zv9):
Chromosome 19 (position 20722243)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20655623
GRCz11 19 20239946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCTGATGAAAATGACCAAGTAGTAGTAAAAATCACAGGCCACTTCTA[T/G]GCAAGCCAGGTGATTGAGCTATTAGATGTTACTCTGCTTATGTAATGGGG
Long Flanking Sequence:
AAGTGAAAACTGTTTCACTTTCTCCAGAGAGTGTACTTGTGCGCGCATCTATATTTGAAATGATGAATTTCTTGAGCTGTTAATACCTAACGCCCGTATGATTATTAAGGTGCCTCTGACATTTGATCCTTTCAGAAACAGACAAACATGAGAGTGAAGCGTGAAAAAACAAAGGAGCAAATGATTCTTTCAGCAACCTAAAACTGCCATGTTTAACTATTATCATCACCTTTTGGACTATTGCGAACCAGGAATGACAGAATTTCTTTCCAACAAAAGATTACATGTGCTGGTGAAGATTAAAGATACAGTTTTCAGTTTTGTTTGAACTATCCCTTTAAGAATTAATTCATCTCCAGAATTTGACTGTGATTGGTACTTTGTGCTTCTCTTCAGGTGAACGAACTACAGAACTTGACCAGTGCGGAGGTGGTCGTCCCACGGGACCAGACACCTGATGAAAATGACCAAGTAGTAGTAAAAATCACAGGCCACTTCTA[T/G]GCAAGCCAGGTGATTGAGCTATTAGATGTTACTCTGCTTATGTAATGGGGTTCAAGAAGTGTATTTAAAAAATTACTGTGTAAAGTATTAATGATTATCTAGAAGTATTAGGTTGTCACGCCAAGCTTGCGGAAGATTAATGTGAACAGTAATAGAAACATGGGAGAAATATGTCCTATAGCTAGGCCAACACGGAATCTTCGTGTGCAGAAATCCACAGATTTTTGGCCCATTATTGAGTCTATATATTTACTTTTGTAAATGTTTGTCAATTTCTATTTAATTAGTTTTTCAATTAATATCAGTAATATTATTGACTAATATGAAACTGTTCATTTGATTTAAAATTCAGTTTGTAAATAAATATGTTCTGTCTTTTAGTATATATATAATAAATGAGAGACTTGTTTTGTTTGCCAAATAACTAGATGAAATTGCTTGGTAAGCAAATTAAACAAAAGTTAAAAGCTCTTATTTTGCTTTGATATATTAAGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Essential Splice Site 550 582 14 15
ENSDART00000133633 None None 110 None 7
Genomic Location (Zv9):
Chromosome 19 (position 20722254)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20655634
GRCz11 19 20239957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGACCAAGTAGTAGTAAAAATCACAGGCCACTTCTATGCAAGCCAGG[T/C]GATTGAGCTATTAGATGTTACTCTGCTTATGTAATGGGGTTCAAGAAGTG
Long Flanking Sequence:
GTTTCACTTTCTCCAGAGAGTGTACTTGTGCGCGCATCTATATTTGAAATGATGAATTTCTTGAGCTGTTAATACCTAACGCCCGTATGATTATTAAGGTGCCTCTGACATTTGATCCTTTCAGAAACAGACAAACATGAGAGTGAAGCGTGAAAAAACAAAGGAGCAAATGATTCTTTCAGCAACCTAAAACTGCCATGTTTAACTATTATCATCACCTTTTGGACTATTGCGAACCAGGAATGACAGAATTTCTTTCCAACAAAAGATTACATGTGCTGGTGAAGATTAAAGATACAGTTTTCAGTTTTGTTTGAACTATCCCTTTAAGAATTAATTCATCTCCAGAATTTGACTGTGATTGGTACTTTGTGCTTCTCTTCAGGTGAACGAACTACAGAACTTGACCAGTGCGGAGGTGGTCGTCCCACGGGACCAGACACCTGATGAAAATGACCAAGTAGTAGTAAAAATCACAGGCCACTTCTATGCAAGCCAGG[T/C]GATTGAGCTATTAGATGTTACTCTGCTTATGTAATGGGGTTCAAGAAGTGTATTTAAAAAATTACTGTGTAAAGTATTAATGATTATCTAGAAGTATTAGGTTGTCACGCCAAGCTTGCGGAAGATTAATGTGAACAGTAATAGAAACATGGGAGAAATATGTCCTATAGCTAGGCCAACACGGAATCTTCGTGTGCAGAAATCCACAGATTTTTGGCCCATTATTGAGTCTATATATTTACTTTTGTAAATGTTTGTCAATTTCTATTTAATTAGTTTTTCAATTAATATCAGTAATATTATTGACTAATATGAAACTGTTCATTTGATTTAAAATTCAGTTTGTAAATAAATATGTTCTGTCTTTTAGTATATATATAATAAATGAGAGACTTGTTTTGTTTGCCAAATAACTAGATGAAATTGCTTGGTAAGCAAATTAAACAAAAGTTAAAAGCTCTTATTTTGCTTTGATATATTAAGTTTTTACAATACTCCCA
Associated Phenotype:
Not determined