Busch Lab

ZMP

asap2a

Ensembl ID:
ENSDARG00000010181
ZFIN ID:
ZDB-GENE-041210-256
Description:
arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 2 [Source:RefSeq peptide;Acc:N
Human Orthologue:
ASAP2
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:2721]
Mouse Orthologue:
6530401G17Rik
Mouse Description:
RIKEN cDNA 6530401G17 gene Gene [Source:MGI Symbol;Acc:MGI:1923478]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11846 Nonsense Available for shipment Available now
sa39170 Nonsense Mutation detected in F1 DNA Not yet available
sa23132 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Nonsense 52 991 2 28
Genomic Location (Zv9):
Chromosome 17 (position 35310033)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35194957
GRCz11 17 35142903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTYTCTGTGTGTGTGTTTAGGCCCTGGATGTGGACCGCAGTGTCCTTTA[C/A]AAGATGAAGAAGTCAGTTAAGGCTATTTACGCCTCGGGTCTGGGTAAGTG
Long Flanking Sequence:
TAGTTCTCCTTATAGTAAACGTTAGTTAATTCGTTAAAATCAAATCAGTGATTACTTTATTAATTACATTTAATGAATTATGCCTTTTTTTCATTAATGGGCATTTACTAAGACATTGACATCACCTTAGATTCATTATTGCCTATTTATTAACTTTTTTTCCTTTAAGTGCCTTAGACTTTGATTATTATTATTATTTTTGTTAACAGTGAATAACTAAAACTTTTAAAGTGCCTTAGACTTCTGTTGTTTATCTTCATGAATCTCTTATCCAAAGAGCACTGACACATTAATTACCCCTGGAGCACTTTTAGTTTGAGTCTGGAGTTAATTATTAGCTGTATTTTGAAGTAACCATGATATTAATATTGTGCACATTTATTATCATTATATAATGAATTTCTGAATATCTGCATTTGTATCTCATATGTATATATCTCTCCTTCTTTTTCTCTCTGTGTGTGTGTTTAGGCCCTGGATGTGGACCGCAGTGTCCTTTA[C/A]AAGATGAAGAAGTCAGTTAAGGCTATTTACGCCTCGGGTCTGGGTAAGTGATCATTCATCATCTCAGCGCCTCTCATGATGTGGCTGTCTGTCGTCTGATTAGATTACAGTCAGGAAATCTCTGCAGCACATCTGCACATTCATCTGACACTAGGAATGTGCTCCGCTTTATCTAAAGGTGACATTTTTGATACATGATATGATGATCGTGCTGAAAAGTTTGGAAGAGGTGGTGGTGGTGTGTTTGGTTTTGATTTTCAGAGATGTTCGGTGTCTCTCTGGGTTTTTACAGTGCTGAATCAATCAGGATTTTACACTTGGTTGTATAGTCCTAGAGAATGTGACTGCTTTTCTGTTGGTTATCTCAATAAATCTGAATTTGTTCATAGTTATTATGGTTGTTGGTGTTGTTTAGCTGCTTTATATGTATTTAATAATACAAACAGTGAAAAGTTTTGAAAGTAGTGCATTACAATATTGAGTTACTCCTCAAAAAAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4721
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Nonsense 564 991 17 28
Genomic Location (Zv9):
Chromosome 17 (position 35370481)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35255405
GRCz11 17 35203351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCACACGCTCTGTGATGCTGTGAAGGCCCGGGACATTTTCTCTCTCATC[C/T]AGGTCTATGCTGAAGGAGTGGATCTGATGGAGCCCATTCCTCTGGCYAAT
Long Flanking Sequence:
ATCATGGAGGCCTGTCTGACGGCAGAAGATGTGATCAAACCGAATCCAGCCAGTGACATGTAAGCTGAAGATTGTCTGAAAATTTCGCATTGCTCTATTAATTTACTAACTTATTCAACCTGAGAGGCTTACCTTTTGTTTGTGTGGTGCACTGTAATGTGTTTATGTTTAGCTTTTAAAAAATCACTTTATTTTCGCATGAGAAACGATTGATGGAAATGACAAATGAAAAGGTGAGGTGCCTGAGGTGGTTTTGAACTTGATATTGTTTATGCTCAAACAGCAACAATACATAAAAGTTCAACTGAAGTAAAAAAAACAAGTAAAATTGTAATCAATGACCTTTTTAAATTCCCTTGTATGACAGGCAGGCGAGGAAGGACTTTATCATGGCCAAATACACAGAGAAACGCTTCGCTCGTAAGAAGTGTCCAGACGCACTGTCGAAGCTGCACACGCTCTGTGATGCTGTGAAGGCCCGGGACATTTTCTCTCTCATC[C/T]AGGTCTATGCTGAAGGAGTGGATCTGATGGAGCCCATTCCTCTGGCTAATGGACATGTGAGTGTTACCATCATACCTCACACTAGATTATATTACATCTTTACAACTTTATTTATAGAGCACAATTAAGTTCAACTTCATTTAAGCAAAGTGCTGTACAAAGATTAAAAAGAGAAAACAGGTGGAAGGAATGAAAAAAGGAATAATGATAGCAATACAAATACAAATTGTACCTAACAAATACAAACAATCATATAATATTTTTTTTATATTATGTTATATTTATTATATTATATTTATTATATAATATTATTATATTATATTAATTATATTATATTTATTATATTATGTTAAATTATATTTATCATATTAAATTTTATTATTATATTAAATTAAATTATATTTATTGTATTATATTTATTATATTAATTATATTTATTATATTATATTATTATATTAAATTAAATTATATTTATTATATTATAATTTTGTTAATTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39170
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Nonsense 663 991 20 28
Genomic Location (Zv9):
Chromosome 17 (position 35375225)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35260149
GRCz11 17 35208095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTTTAAGCTAATGAAGCTGGAGAGACCCCGTTGGACATCGCCAGG[C/T]GACTCAAACATCTGCAGTGTGAGGAACTGGTGAGCCCTTTTGCTCTTGTA
Long Flanking Sequence:
TGGAACAAATTAGTTTAAAAACTGAATATAAATGTACACTCACTTACACAAGTAAATAAAAAGACTTAATGGGCTAAAAGTCTGCGGATTTCTGTGGGCACAGATTCCGTACTGATCTATGACTATATGCTAGCCATCATGGTTTCAGCAAAAATCTTATTTTAAAAATCCGTCTTATACGGGTGAAGGCCGATTAAATAGACCCCATATTTTCACTTTCACTTCAGCAGTGTTCCCCAAACAATGGCAAGAGCAGATAAGAGCTGCATGTGTCTGAGTGTGTGTGTGTGTGAATCTGTGCCAGGGAGTCTCCTCTCCATTATTTCTGCCAGAGTCTTCTGTGAGCAAGCTGTCTGGATCTTTGTTCAACTCATTGCACAAAGCCAAGAGTACTAAATGTCATGGGACATCCTCCTTCTTTATTAAATGCATCATAGCTGTGTTTGTTTGTGTGTGTTTAAGCTAATGAAGCTGGAGAGACCCCGTTGGACATCGCCAGG[C/T]GACTCAAACATCTGCAGTGTGAGGAACTGGTGAGCCCTTTTGCTCTTGTAGTTTAATATGAGATGAAAGCGCGCTGGGTTTATGGTGTCTCTGTGTGTGTGTTTTAGCTGAACCAGGCTCTTGCAGGGAAGTTCAATGCTCATGTGCATGTGGAGTATGAGTGGAGACTTCAGCATGAAGACCTGGACGAGAGTGATGAAGATCTGGATGAGAAGGTGAAAAACGACTCGATGCTTGTATTCGATTTTGACTTATGACTAGGCCAGATTTCCACAGATTTTAAGCCCATCAAATATATTTCTTTACTTGTGTAAATCTATATTTACTCCGTTTTTACATTTATTTCAGTAATATTATTAACTAACATGAGAGTGTTCACATGATTTATTTACAGTAAAGTTTGTGCAGTAATATTTTGTCCTTTAGTAGATGTATTATGTGAGAGACTTGCTTTGTTTATCAAATAAGCGGATCTAGATGGATTTGCATTGTAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23132
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Essential Splice Site 874 991 24 28
Genomic Location (Zv9):
Chromosome 17 (position 35382928)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35267852
GRCz11 17 35215798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACCCGGACAGGGGCCTCCTGGACAGAACATCAACCGGGCTACAAGG[T/C]CAGATTAACAAATAACCCATTACCACAAGCACACACTCTAATATACTCAT
Long Flanking Sequence:
TCAAATAATCATTGTGAACGTTCTTACTGTAGTATTTCTAATAAAGGTTACGAGACATCTGCTTCCTCCATGATTGTCACTGTGCTGTTTATCTGACGCAGCCATGGTGGAGATCGAGGCACACTCTGAGAGGCATATGGGAATGGTGGGCGGGGAGGACTAGCATTAAAGGCACAGGCCACAAAAACAGCTACATTGTGTTTAGAGCAGAAAACCCCAATATTTTAAAAGGTATAATAAATAATCTGATGTGTGTTTTGAGGTGAAACTGTCCAGACACATTCTTGAGACACAAAAGACCTCTCTTAAATCTTGAAAAAGGGGTCAAATTGGTGCCCTTTAGTGTAATGATGTTTGTTGTTGATGCTCTATTTGCAGTTCTAATGCCCAGCGGTGCTGCTCCTCCTCTGGCTAAAGCTACTGGTATGATGGAGACCATGAATATGCAACCCAAACCCGGACAGGGGCCTCCTGGACAGAACATCAACCGGGCTACAAGG[T/C]CAGATTAACAAATAACCCATTACCACAAGCACACACTCTAATATACTCATGTCCTCTGACAGTCCTGCCCTACAGGACAACTCCATTAAACTCATTATATCTCCAAATAGCCGCTGGTGAAAATGTTTGTTGAGTCTGACTCCAGTAAAAGGTGAACACAAAGGTGGAAATGGCCTGTTGGGAACTGCAGATTCACCAGCTCATTAATTCCTATTCAAGGCCTCATTCACGCACACAGTGCCAGAGGACCAGACAAGTAGGCCACTCGGATTACTAATGGGGTTACCTTGAATGACCCGAGCACAAGACCCTGTTTCCACGTGATATTAACATGCAGTCTCATGGCCACTTGTGTTTAGATTTCATCGAGACCCTCTTATTTCAGCATGCTCTAGAGTACTTTTGCCGGAGCTCTCAGTGTAAAACTAATAAAAGATGTGGATGTTAACTTTAGTTTAACGGTTATTTGTGTGCTTGTGTACAGTGCAGCCAAGTATGAA
Associated Phenotype:
Not determined