Busch Lab

ZMP

trim13

Ensembl ID:
ENSDARG00000010010
ZFIN ID:
ZDB-GENE-050522-516
Description:
tripartite motif-containing protein 13 [Source:RefSeq peptide;Acc:NP_001018439]
Human Orthologue:
TRIM13
Human Description:
tripartite motif-containing 13 [Source:HGNC Symbol;Acc:9976]
Mouse Orthologue:
Trim13
Mouse Description:
tripartite motif-containing 13 Gene [Source:MGI Symbol;Acc:MGI:1913847]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa76 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa76
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023210 Nonsense 43 414 2 2
Genomic Location (Zv9):
Chromosome 9 (position 30680589)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29836535
GRCz11 9 29647281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGAGGACCCGCGCGTTCTGCCCTGCTCTCACAGCTTCTGCAAGAAGTG[T/A]CTGGAGGGTATCCTGGACGGTAACCGGAGCCCTACATGGAGACCACCGTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461