Busch Lab

ZMP

icn

Ensembl ID:
ENSDARG00000009978
ZFIN ID:
ZDB-GENE-030131-8599
Description:
ictacalcin [Source:RefSeq peptide;Acc:NP_997926]
Human Orthologue:
S100P
Human Description:
S100 calcium binding protein P [Source:HGNC Symbol;Acc:10504]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42714 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22831 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004679 Essential Splice Site 4 95 1 3
Genomic Location (Zv9):
Chromosome 16 (position 25670551)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23516226
GRCz11 16 23431258
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCACTTGTTGCCCATCGTGACCACCAGAACCACCATGGCTACGTCAG[G/A]TAAGAGGCCAATTTTTTGTTCTAAAATTGTTTTTCTGTCTGTTTAGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22831
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004679 Essential Splice Site 5 95 2 3
Genomic Location (Zv9):
Chromosome 16 (position 25671259)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23516934
GRCz11 16 23431966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATTATTGTTAATTATAACTAACTCATTTTGTTTCACACAAATTTTGC[A/C]GATACCCAGAAAGCAATGGCTATGCTCATTGCAACCTTCCACAAATACTC
Associated Phenotype:
Not determined