Busch Lab

ZMP

ntla

Ensembl ID:
ENSDARG00000009905
ZFIN ID:
ZDB-GENE-980526-437
Description:
Brachyury protein homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q07998]
Human Orthologue:
T
Human Description:
T, brachyury homolog (mouse) [Source:HGNC Symbol;Acc:11515]
Mouse Orthologue:
T
Mouse Description:
brachyury Gene [Source:MGI Symbol;Acc:MGI:98472]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13983
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007356 Nonsense 138 423 2 8
Genomic Location (Zv9):
Chromosome 19 (position 30637134)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14328622
GRCz11 19 14190817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCRCCCAACTTCGGCGCGCACTGGATGAAAGCACCCGTATCTTTCAGC[A/T]AAGTCAAACTCTCCAATAAACTYAAYGGAGGAGGRCAGGTAATGATTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29227
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007356 Nonsense 397 423 8 8
Genomic Location (Zv9):
Chromosome 19 (position 30634803)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14326291
GRCz11 19 14188486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCGCTGCCTGTGTCCTCTCCCTCCTCAATGTACGATCCAGGCCTAAGC[G/T]AGGTTGGCGTTGGAGATGCCCAGTTCGAGAGCTCCATCGCCCGGCTCACA
Associated Phenotype:
Not determined