Busch Lab

ZMP

rnf114

Ensembl ID:
ENSDARG00000009886
ZFIN ID:
ZDB-GENE-040813-1
Description:
RING finger protein 114 [Source:RefSeq peptide;Acc:NP_001001828]
Human Orthologue:
RNF114
Human Description:
ring finger protein 114 [Source:HGNC Symbol;Acc:13094]
Mouse Orthologue:
Rnf114
Mouse Description:
ring finger protein 114 Gene [Source:MGI Symbol;Acc:MGI:1933159]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37598 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37598
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019667 Nonsense 22 221 1 6
Genomic Location (Zv9):
Chromosome 23 (position 3524720)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3568153
GRCz11 23 3511056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGACCCGCAAACCGACGTAAACGATGCTGAAGACGACGACTTCGTGTG[T/A]CCCGTGTGTTTGGAGATATTCGTCCGGCCCATGACCACGCAGTGCGGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1258
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019667 Nonsense 107 221 3 6
Genomic Location (Zv9):
Chromosome 23 (position 3520864)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3564297
GRCz11 23 3507200
KASP Assay ID:
554-1173.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTTCTTATTTCTGACATGAGAAGCCACACAGGAAATTGCTTCAAATAT[C/T]AAAACTACATCCAGGAGGGTATGAAGTCCATTTCAAAAGACCAGCCCTCC
Associated Phenotype:
Not determined