Busch Lab

ZMP

raf1a

Ensembl ID:
ENSDARG00000009875
ZFIN ID:
ZDB-GENE-990415-41
Description:
RAF proto-oncogene serine/threonine-protein kinase [Source:RefSeq peptide;Acc:NP_571514]
Human Orthologue:
RAF1
Human Description:
v-raf-1 murine leukemia viral oncogene homolog 1 [Source:HGNC Symbol;Acc:9829]
Mouse Orthologue:
Raf1
Mouse Description:
v-raf-leukemia viral oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:97847]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37605 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29867
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044242 Nonsense 82 643 3 18
ENSDART00000098194 Nonsense 125 654 3 17
ENSDART00000105473 Missense 46 248 3 18
ENSDART00000143595 Nonsense 82 187 3 5
Genomic Location (Zv9):
Chromosome 23 (position 4769293)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4778881
GRCz11 23 4714754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGCCAGGCATGACGCTCCACAGCTGTCTGATCAAAGCGCTGAAGGTT[C/T]GAGGACTCCAGCCGGAGTGCTGTGCTGTCTTCAGTCTCCATCCTGGACAG
Long Flanking Sequence:
TATTAACTAATTGACTTAGGTAAGCCTTTAATTTATAGGTATTAGCTACAACTGCAGCATTTAGTGGTCAAAATAGACATTGATACAGACAGTAAAACTGATGCTAACGCTGATATGAGGCAGTTTTGTTACAATCTTTATAAGTTTGTGCAGGATGTAAAGCTAAGTCTTTCGGAAGACAGTATCTCAATTTATTGTAGACTTAATTTATTGTGAACTTTCACATTTACAAACTACTTCCATCAGTAAATGCATAAAAGAGGCACCTTAAATACCATTTTAAGATTTGGAGGATGACATTTTCAGGCTGTCTTTCAAGCACTTGCTGCAGTTAAAGTAAAAAAAAAAAGTAGTAATGTTTAAAAGAATGGGAAGTGAAAGGCAGTTAAAAGCAGTACATGTGTATGGTCTTGTGTGTGTTTATGTCCACGCTCCCTCTGAAGGTGAATGTGCGGCCAGGCATGACGCTCCACAGCTGTCTGATCAAAGCGCTGAAGGTT[C/T]GAGGACTCCAGCCGGAGTGCTGTGCTGTCTTCAGTCTCCATCCTGGACAGAGAAGGTCAGGTCAAGTTCATTTATTTATAAAGCACATTAAAAACAGCCACAGGCTGACCAAAGTACTGCACATAACACCAAACTGCATGTAGAGAAAAAAATACTTAAAATCAGGAAAATTTAAATCCAGAAGATTAACAGATTAATAATACGAAACAAAGGAATGCGTATGATATTAATAAGCCAGATTGAACAGATATGTGTTTAAAAGTGGTTTAGTAATGATAAGCGAAGGTGTCACTCTAATCTCATGTGGAAGATTGTACCATAATGCCAATTTCAGACTGCATGATTTTAGCCATGATTTTGACTCGCTGACAGGTTTTGAGAAATTGCCGAAATCGGTGCTCGTGCACGTAAGTGACAATCACACAGTATAAACTAGAGATCTGCGCGGGACTAAATTTTGAATCCCGCTTCCGCCCGCACCCGCCAAGTTTTAGCCCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37605
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044242 Nonsense 361 643 11 18
ENSDART00000098194 Nonsense 372 654 10 17
ENSDART00000105473 None None 248 11 18
ENSDART00000143595 None None 187 None 5
Genomic Location (Zv9):
Chromosome 23 (position 4790942)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4800427
GRCz11 23 4736012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTTGTGCTACTGAGCAGGATTGGGTCAGGCTCCTTTGGAACCGTACAC[A/T]AAGGGAAATGGCACGGTAAGCATCGGTTTAGTGCTTCTTTCAGTAAAATA
Long Flanking Sequence:
GTATACTATAAATACTTAAATAAACAAATTACCTGAGGCATGCTATATAAGTACTTTTACATAAGCCAGAACAATGTTGCGCAAGATTTTTTAAAAGAGGTATTTAAAGTTTAAAAAACAAGTAGTGCGACATACAAGCTGAACTCTTCTAGACATCAGCTATCAACTGTAATACCTTTATTATATAAACAGCTTTATTTAGTCTTCAAAAATGAACGAATACTTCAATAATATTTACACATTAATTATTTATTACGGTGATTTGAAAATGTGATTAATTTTGAGAGGAATTTCTCAATGCTAAACGTTCATTTTAAAAAGTGTTTTGAGGAAGAAATATGATTTTGTTATTTCAGCGTGCTTTCTTGTGGTTCTTAACATGAGTTATTGTTTTCTAGCGGCCGAGGGATAAACGGGACTCGAGTTATTACTGGGAGATCGAAGCTAATGAGGTTGTGCTACTGAGCAGGATTGGGTCAGGCTCCTTTGGAACCGTACAC[A/T]AAGGGAAATGGCACGGTAAGCATCGGTTTAGTGCTTCTTTCAGTAAAATAGCCTTCTTAGGGACACATTATGACTGTTATCTTTAACATGCTGTAGGTGATGTGGCTGTGAAGGTATTAAAAGTCACCAACCCAACACCAGAGCAGTTTCAGGCTTTCCGCAACGAGGTGGCAGTTCTTAGGTAAGCATTTCTTCTTGATTATTAGTACATCAGTGCAGGTTTTGTTTTGTTGATGGCTTTTGAATGTCAGTGGTTTCATTTTAATGTGCAGTCCCAGGACAAATTCATTTAGTATTCATTTAGTCATTTAGCAGATGCTTTTGTCTAAAGCAACTTACAGTTGAAGAGGCATTTAGCAATTCAACAAGAGGCAATACACACAAGAAGTGTTAATATTACAAAGAAACTGTTAGTGCTCAGGGAATAGAGTGGAGGAACTTTGACGTCACCTTGTAGGCTAATCAGCTGCTAGCATAAAACTGGTTCCCTCAACAAAATC
Associated Phenotype:
Not determined