Busch Lab

ZMP

adssl1

Ensembl ID:
ENSDARG00000009867
ZFIN ID:
ZDB-GENE-040516-18
Description:
Adenylosuccinate synthetase isozyme 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NSN5]
Human Orthologue:
ADSSL1
Human Description:
adenylosuccinate synthase like 1 [Source:HGNC Symbol;Acc:20093]
Mouse Orthologue:
Adssl1
Mouse Description:
adenylosuccinate synthetase like 1 Gene [Source:MGI Symbol;Acc:MGI:87947]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15358 Essential Splice Site Available for shipment Available now
sa11426 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15358
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046077 Essential Splice Site 158 456 5 13
ENSDART00000134675 Essential Splice Site 120 193 4 7
Genomic Location (Zv9):
Chromosome 17 (position 961857)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 675024
GRCz11 17 1335290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCGTGGACGGACTTCAGGAGACTCAAAGACAAGCTCAGGAAGGCAAAAA[G/A]TAAGAACAGAACAAMAGGCTAGTGTATGGCTTGTTRATTTTTGTTNNNAA
Long Flanking Sequence:
CCTCATGCGTATTTACCGCCTCTCCCTTCTCGTTAAATCGAAACCGGAAATACTGCCCAACTGTGATGACAACCACGCATACACATTTTTTAGGCATTAAATAAACTATATTTAGTAATTAATCCTTGTCTCCTAAATAAGTGCATTGACGGTATAACGGTATTAAAACTGATACCGTTGCTATTTTTAGATCCCGCAGTATATCATATTACCGCCCAAGCCTAATATGCAAACATGAATGCTTTTTAAATCATAGGAATAATTGTTTATTCTTTCATGAAAAGGGCTGAAAGGATGGGAGAAAAGACTGGTGATCTCAGATCGGGCTCACATCGGTAATATAACCAAACCTAAACAATAGTGCGTGCTTGTGTCTGTGGTGAAAGATATGAAGAATGAGAGATGATCTCACGATTGCATGTCTCTCTGTCAGTGTTTGACTTTCATCAGGCCGTGGACGGACTTCAGGAGACTCAAAGACAAGCTCAGGAAGGCAAAAA[G/A]TAAGAACAGAACAACAGGCTAGTGTATGGCTTGTTGATTTTTGTTATAAAATGGATGATTCTGATTGGTTTAGCCACATTCTAAGCTGTGCTGAACATATGCTGCTTCCCAATTCACCTAATTATACTATGTTATAAAGCATGAAATAATATTAATTCCTTACATTTATAAAGCACTTTTCTGGGCACTCAAAGTGCTTTACACATTGGGGGGAATCTCCTCATCCACCACCAGTGTGCAACATCCAGTTAATGTCAGAATTATTAGCCCCCCTGAATTATTAGCGCCCCTCTTTATTTTTTCCCCAATTTCTGTTTAATAGAGGGAAGATTGTTTCAGCACATTTTTAATCATAATAGTTTTAATAACTCATCTCTAATAACTGATTTATTTTCTCTTTGTCATGATGACAGTAAATAATATTTGGCTAGATATTATTCAAGACACTTCTATACAGCTTAAAGTGACATTTAAAGGCTTCACTAGGGTAATTAGGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11426
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046077 Essential Splice Site 194 456 6 13
ENSDART00000134675 Essential Splice Site 156 193 5 7
Genomic Location (Zv9):
Chromosome 17 (position 965882)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 679049
GRCz11 17 1339315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCCTTCGCATTTGTGAYCTGATGGCTGATTTCAATGAGTTTTCMACAAG[G/A]TAGATCCTCTRWAAATGCTGAAAAACAAGCATACRTGAGTGCAGTWGTTC
Long Flanking Sequence:
CGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGTGTATTTTATATAATTAATATGTATATGGGATACGAACACATACTTACAAAACAGAACTTTTTTGCCACATAGATTGATAAATTTCTATAATATTTGTGTCATATGCATATATATTTTATATGTAAATATAATTAAACTTTTTCTAAAATATATGCATGCATGTGTGTATTTGTATATACATAATAAACATAAACAATACACATATATTATGTAAAAAAAACAACTTTTATTTCAGACTTGGCCAGTTTTTTTGTTTTTTTTGTTTTTGTTTTTTGTTAGTGATGATATTAATTGTGTGTATTTATTCACAGCATAGGAACAACTAAGAAAGGCATCGGACCCACATACGCCTGTAAAGCGTCTCGCACTGGCCTTCGCATTTGTGACCTGATGGCTGATTTCAATGAGTTTTCCACAAG[G/A]TAGATCCTCTGTAAATGCTGAAAAACAAGCATACATGAGTGCAGTAGTTCAGAAGTGTTCATTACTGTCTCCTGAAGGGTGAAGAACCTGGTCCAGCAGTACCAGTCCATGTACCCTACTCTGAAAGTGGACGTGGAGAGCGAGCTTAAGAAGCTAAAGGTCAGTAAAACCATTACATTTTTTTAATAATAAACTTATTTATTACTGCTTGTATACGGTCACGATTCTTCACATTTGCAATGTTGCTGCTGTTTAATGTCATTCATCTATTCTGTCATCTGCACTTGAATATATATATATATATATATATATATATATATATATATATATATATCTGATGTCACAGTGATATTGTGATATTGTTGTCAGTTTCACATTTTTCAATATTAGTCGCTAAATGTTTTCTAAATGCTCTTAATTTAAAGTAAAAGTGAGTATTCCTATCAGCAAACACTAACTGTGAGGTATATTAGTGTGAGTATTGTGAAGTATTGACTCGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28771
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046077 Nonsense 266 456 9 13
ENSDART00000134675 None None 193 None 7
Genomic Location (Zv9):
Chromosome 17 (position 972992)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 686159
GRCz11 17 1346425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTTCATGTATATCTTAAAGGCTTGTTTTTCACCTTTGTAGGAACGTA[T/A]CCTTTTGTGACGTCGTCTAACTGCACTGTTGGCGGTGTGTGTACGGGTCT
Long Flanking Sequence:
ATTTTAAAGTCCGCATGAGCCGGAAGCTGTGACTGTTTTTTTTTACTTTGTGATGCAGTTCCCACAGAAACGGAATATTAAATGATTAAACAGTGGGTGTGGCTTGTTTTTTCTACTGCGAGCTGATTGGATGTAGTAAAGTAGGCGTTTCATTTAGAAGGATGGGGAAAAGGAGTTTGGGGAGAGTAATTACAACCTAACAGACTTCTCCGGCTCAACATTTCTGTCTGCTGTCAAAACTGACAGCTGGAGGATTCTCAGATTAGGTCTGTTTGAGGTACTGGGCGTGGCTAACATACTTAACCACGCCCAGTACCTCAAACAGACCTAATCTGAGAATGTAACTGAGAACTAACAGGAAGTGCATTTTCAGATTTCAATTAAAGGTTAAGTTTTTTTGTTCTTAATGACATGCACAGATGAATTGTTCACCAAAATTCACCACAGTTTTGATTTCATGTATATCTTAAAGGCTTGTTTTTCACCTTTGTAGGAACGTA[T/A]CCTTTTGTGACGTCGTCTAACTGCACTGTTGGCGGTGTGTGTACGGGTCTCGGCATCCCTCCTGCAAACATCGGCGATGTGTATGGAGTGTCAAAGGCCTACACTACTAGAGTTGGGATCGGGGCCTTTCCTACAGAACAACTCAATGTAGGACAAACACCCTTTATTATTATTGTACTCCATACAATACAGATACGGATACTGGAAAGTAATCAATGATGCAGACTCTGAGACTAACTGCATTTTCAGCTACTTGCAGTTGGGTTATAATTAGGGATGCACAGTGTATTATGTATTATTTTCACTTCACATGTTGCCCACACTTCACATTTGCTGCCTACCACTTTTTTTACTGGTATTTTGATATTGGTTAATGATCAATTGGTTGGTTTATTTATGCATTATTCTATATAAAAGAAAGTTAGCTACAGAAAAGAATAGTTGATTATGTTCAGAAATCAGTTCAAGCTTTTCTAAAGTTAAGATTTTAAAATAAAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28772
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046077 Nonsense 454 456 13 13
ENSDART00000134675 None None 193 None 7
Genomic Location (Zv9):
Chromosome 17 (position 979704)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 692871
GRCz11 17 1353137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCACAGTTAAATGGGTCGGCGTCGGCAAATCCAGAGAATGTATGATC[C/T]AGATGTTTTAGGATTATTACCCACAATCCTCCAGTGACGCCTGTCTGAAG
Long Flanking Sequence:
ACAACTCAGTTTTGTTCAGTTCAGTACGACTCAGTTCATTTTAATGCACCTCAGTTCAGATTGATTCACTTCAGGTGAGTTCAATTCAATGCAATTCAGTTTAGCTCTGTTAAAGTTTGAGCATAGCTCTTTTCATGATAGATGATACATCTTTACAGCAGTTTTACAAAATAGATTATCGTGTTCTATCTGTTATATTATCTATATTATTATTACTTAAATATAACTTATTTTATTCCAATGATTATATATTGAATACTGATTATTATTTACTATTAAATTATATAATCATTGACAATAATTCTTAATTATTATGTTTATAATTCATTACTAATTGTAGTATTTATTACTTTGTTGTGTTTTGTGTTATTATGACCAACATCTTCCAAATATCTCTTCAATTTATCATTATTCTTTTCACGGCAAATATTTTAACTCTGCTTCACTTCTCCCCCACAGTTAAATGGGTCGGCGTCGGCAAATCCAGAGAATGTATGATC[C/T]AGATGTTTTAGGATTATTACCCACAATCCTCCAGTGACGCCTGTCTGAAGATCAGCAGCAGTGTTTTTGCTGACCCCCATTCACTTGCCCATCAGACTCCTTAAAGGGACAGTTCACTGAAAATCATAATTCTGGCATTTACTCTCCCTTCACGTGTCCCAAACCTAATTGAGTTTCCTTCTTTTGTTAAACACAAGTGAAGATATTATGAAAAATTCTGGAAAAAAACAGCCATTTGCAGCCATAGTTTTTTTTTTTCATGAAGCTTTGAAACATTCACAAATCATTTGTTTTCGAATCAGTGATTTCGGAGCACGTATCAATCAGATAAAGTCATGTCATTTCAGTAAACGAGGCTTTATTACATCATTAGTTTGTAAACATTGAGATAATTCAATGTTTCTCCACTGGGAGGCGATCTGTGTAATATTATAACATCCGCATGAATCACAAAAGTCATTCAGTTTGTCCCCTAGTGGCGAATCACTGAACTGCTTCAT
Associated Phenotype:
Not determined