Busch Lab

ZMP

cyp19a1b

Ensembl ID:
ENSDARG00000009852
ZFIN ID:
ZDB-GENE-001103-4
Description:
cytochrome P450, family 19, subfamily A, polypeptide 1b [Source:RefSeq peptide;Acc:NP_571717]
Human Orthologue:
CYP19A1
Human Description:
cytochrome P450, family 19, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2594]
Mouse Orthologue:
Cyp19a1
Mouse Description:
cytochrome P450, family 19, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88587]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24593 Essential Splice Site Available for shipment Available now
sa5094 Nonsense F2 line generated Not yet available
sa37992 Nonsense Mutation detected in F1 DNA Not yet available
sa37991 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24593
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Essential Splice Site 150 511 3 9
ENSDART00000055885 Essential Splice Site 149 400 3 10
ENSDART00000130307 Essential Splice Site 150 511 4 10
Genomic Location (Zv9):
Chromosome 25 (position 4911544)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4772786
GRCz11 25 4899214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGCAACATCGCAAAGTGGAAGAAAGTGAGAACATACTTCACTAAAG[G/C]TGAGTGTTAATCTCTGGTCTCACATCATTTCACACAGAGAATCATCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5094
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Nonsense 381 511 8 9
ENSDART00000055885 Nonsense 349 400 9 10
ENSDART00000130307 Nonsense 381 511 9 10
Genomic Location (Zv9):
Chromosome 25 (position 4908506)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4769748
GRCz11 25 4896176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCATCCGGTGGTGGATTTCATCATGAGGCAGTCTCTGGAGGAYGACTA[C/A]ATTGATGGCTACCGGGTGGCAAAGGGGACAAACCTAATCCTGAACATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37992
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Nonsense 407 511 8 9
ENSDART00000055885 Nonsense 375 400 9 10
ENSDART00000130307 Nonsense 407 511 9 10
Genomic Location (Zv9):
Chromosome 25 (position 4908430)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4769672
GRCz11 25 4896100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAAACCTAATCCTGAACATTGGACGCATGCATAAGACAGAGTTCTTC[A/T]AAAAACCCAACGAATTCAGCTTGGAGAACTTCGAGAACACTGTAAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37991
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025590 Nonsense 427 511 9 9
ENSDART00000055885 None None 400 None 10
ENSDART00000130307 Nonsense 427 511 10 10
Genomic Location (Zv9):
Chromosome 25 (position 4905898)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4767140
GRCz11 25 4893568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTAGTCTTATCAACTCTGCCTCCTTCTCAGGTTCCCAGTCGTTACTTC[C/T]AGCCATTCGGTTGTGGTCCGCGGGCCTGTGTTGGGAAGCACATTGCTATG
Associated Phenotype:
Not determined