Busch Lab

ZMP

wdr41

Ensembl ID:
ENSDARG00000009851
ZFIN ID:
ZDB-GENE-050706-152
Description:
WD repeat-containing protein 41 [Source:RefSeq peptide;Acc:NP_001025432]
Human Orthologue:
WDR41
Human Description:
WD repeat domain 41 [Source:HGNC Symbol;Acc:25601]
Mouse Orthologue:
Wdr41
Mouse Description:
WD repeat domain 41 Gene [Source:MGI Symbol;Acc:MGI:2445123]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45727 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17407 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45727
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021272 Essential Splice Site 55 282 2 14
ENSDART00000121813 Essential Splice Site 55 449 2 13
Genomic Location (Zv9):
Chromosome 21 (position 7549211)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7871678
GRCz11 21 7609346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGACACTTTGACATTGTTCGATTTCTGGTGCAGATTGATGACTTAAGG[T/C]AAGCAATCCTCTTCTCCTCTGACCAGTGATTGACAGCTCCGACCGAGCCA
Long Flanking Sequence:
GTAAAACATATGCCACAATAGTTGGCGGTTCATTCCGCTGTGGCGACCCCTAAAAAATAAGGGACTAATCTGAAGGAAAATGAAGGAACCTATTATTCTACAGAAAAGCTGCTATCAGCCATACGTTTGAGCCATGCATTCTCCAACTTCCCGAAACTCCAGAGTTTTGTAGCATGACCCGCATCCATTTTACTGCCATTATTTACCAATAAGCAGCAGACGAGAAACGAGTTTGAGTGTCCAGTTGTCTTAAAGACGAATCTTGGAGTACATGTATCAGAGAGACAGGCCGACGCAGTCCAGCAAACAGCAGTCATTTCAGCACATTCGGAGCTAGATTGAAGCAATGATTCGTTTGTCTATTATATTCCCTCCGTGGGCAGAAGAGCGCGGCGCTGTTCATTGGGGAGGAACAGCCCAAAAACTGCTTCACGGAGATGCAGGTGCTGAAAGGACACTTTGACATTGTTCGATTTCTGGTGCAGATTGATGACTTAAGG[T/C]AAGCAATCCTCTTCTCCTCTGACCAGTGATTGACAGCTCCGACCGAGCCAGATCCTCTCCAAAAGCAGACTTACAGAGCGTGACAAGAGCTTAATCATCACAGCTGGAGGGTGTGTGTGTGTGAGTGTGTGTGTGTGCTCTCTTGATAGTGTCCATCTGATCTGGACTCGTCCGCATATTGAGGTAAAGTTGGTTTTATATTCGCACATTGGTCACATGTGACACACTCTCTATATTTTTACCCATGCTACTTTGAATATTTGGTCTGAAATCGCATGCAAGTGTGACTTCAAAACAACATTAGCACTATTTAACTGACTGTGAAAAGTGTTTTACTTTGACAGTCATTGGCTACCAATATGTTTTAACTATTTAGAATTTGCAAAGAGAAGGTCGCTGGTTCGAGTCCCGGCTGAGCCAGTTGGATTTCTGTGTGGAGTTTGCATGTTCTCCCTGTGTTCGCGTGGGTTTCCTCTGGATGCTCCGGTTTCCCCCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17407
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021272 Nonsense 77 282 4 14
ENSDART00000121813 Nonsense 77 449 4 13
Genomic Location (Zv9):
Chromosome 21 (position 7554173)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7876640
GRCz11 21 7614308
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCNTTTTTTAGCCTTKTATTTTGTGTGTTTCAGACTGGTGATTGTTTGT[T/A]GGAGTTGCGCGGCCACACACAGCAGATCACAGCRATGACATCATACACCT
Long Flanking Sequence:
TTTGCAGATATTTAAGAAACATGCTAGGTGAACATTCTTGTTTATCTGAAAAACAGTGCTGAAAATGTGTTTTCTGTGTCGGAACGGCTGTCTTTGTTTTGGTTCTTTTAACCTGCCCACGCACCCCAAGTTGCCTTGATAGAAAACCGCATATTTCATTCATTCAGTCAGAAAGGCTGTCTGATAAAGGGGTCGAGTGAAAATGTGTTTTCATTCAGGAGTGCAATACCTAGTTCAACCACTGGGTGTCAAACTTGCATACATCTTTAAATATAAACACTTTAATTTGTTTTTGATAAGAATATGTTAGAGTTTAGATTCTCTGCCTGAGCCTAGACTTGACCCAACCTGACCTGACCGGGCTGGGCTGGGCTGATATTTCCTGCCACTATCTTTTGGGCCAGGGCCGGGTCGTGATTAAGAATATGTTTTAGCTGTTGTTGTTTTCTCAGCCTTTTTTAGCCTTTTATTTTGTGTGTTTCAGACTGGTGATTGTTTGT[T/A]GGAGTTGCGCGGCCACACACAGCAGATCACAGCGATGACATCATACACCTTCATCAGAGGAGGAAACACACACACAGCTCTCATCACGGCCTCTTCAGATCGAACACTCAGTGTATCCTGAACAAACATCTGATCAAAGGTGTTTGTGTTTTGTGTTACTGTTTACCTCCTTAACTCAGCAGCAGTTGTGGGATCCAGATTCAGGAAACCGAGTGCAGAATATATCAGATCTGCAGTCCTCTGTAAAGGTGTGTGTTGTGTTCCTGTTTCATTGTGCCGATGGTTTGGGGTGTGTGTCTGTTCCTCTTTTAGAGTGTGTTTAGACTGATGTGTGTGTGTGTGTTTCAGTGTTTGCTGGTGTTGAATCTACTGGACATGTGGCTCTCAGGAGGAAATGAACTGTGTGTTTGGAACCAAGACTTTGAGCTGCAGTGTAAAACAGTTCATCACAGTGACACAGGTACACAATCCAAAACACACAGAAACAAATACACACATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4935
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021272 Nonsense 137 282 6 14
ENSDART00000121813 Nonsense 137 449 6 13
Genomic Location (Zv9):
Chromosome 21 (position 7554526)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7876993
GRCz11 21 7614661
KASP Assay ID:
554-3598.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCTTTYAGAGTGTGTTTAGACTGATGTGTGTGTGTGTGTTTCAGTGTT[T/A]GCTGGTGTTGAATCKWCTGGACATGTGGCTCTCRGGAGGAAATGAACTGT
Long Flanking Sequence:
CTGACCGGGCTGGGCTGGGCTGATATTTCCTGCCACTATCTTTTGGGCCAGGGCCGGGTCGTGATTAAGAATATGTTTTAGCTGTTGTTGTTTTCTCAGCCTTTTTTAGCCTTTTATTTTGTGTGTTTCAGACTGGTGATTGTTTGTTGGAGTTGCGCGGCCACACACAGCAGATCACAGCGATGACATCATACACCTTCATCAGAGGAGGAAACACACACACAGCTCTCATCACGGCCTCTTCAGATCGAACACTCAGTGTATCCTGAACAAACATCTGATCAAAGGTGTTTGTGTTTTGTGTTACTGTTTACCTCCTTAACTCAGCAGCAGTTGTGGGATCCAGATTCAGGAAACCGAGTGCAGAATATATCAGATCTGCAGTCCTCTGTAAAGGTGTGTGTTGTGTTCCTGTTTCATTGTGCCGATGGTTTGGGGTGTGTGTCTGTTCCTCTTTTAGAGTGTGTTTAGACTGATGTGTGTGTGTGTGTTTCAGTGTT[T/A]GCTGGTGTTGAATCTACTGGACATGTGGCTCTCAGGAGGAAATGAACTGTGTGTTTGGAACCAAGACTTTGAGCTGCAGTGTAAAACAGTTCATCACAGTGACACAGGTACACAATCCAAAACACACAGAAACAAATACACACATCAGTATGGAGTTCCTTAAAGTGCAACTTAAATCTGCTGTTGCCTTTTATGTTCATTAAACTAAATTGGCAAAGTAATTTTCTAACTATAATAAGAAGGTTTCTGAAGCTCACCAAGCATGAATTTATTTGGTGAAAATACAGTGAAAACAGTAATATTGTGAAATGTTATTACAGTTTTTAATAACTTGTATCTAGTATCTGATATCTTTACTGATAATGTAATGTATTTTATTTTGTCAATTTATTTGGAAGGAATTTCTGCAATGGTGGAGCTACCGAAGAACTTCATCGCAGCTGCCATGGATAAAGAGATTGGTAACACAGACACACATACTGTACATACATGCATAAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29517
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021272 Essential Splice Site 193 282 7 14
ENSDART00000121813 Essential Splice Site 193 449 7 13
Genomic Location (Zv9):
Chromosome 21 (position 7554988)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7877455
GRCz11 21 7615123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGGAGCTACCGAAGAACTTCATCGCAGCTGCCATGGATAAAGAGATTG[G/A]TAACACAGACACACATACTGTACATACATGCATAAATACATACACCGCAA
Long Flanking Sequence:
TGTGTTTAGACTGATGTGTGTGTGTGTGTTTCAGTGTTTGCTGGTGTTGAATCTACTGGACATGTGGCTCTCAGGAGGAAATGAACTGTGTGTTTGGAACCAAGACTTTGAGCTGCAGTGTAAAACAGTTCATCACAGTGACACAGGTACACAATCCAAAACACACAGAAACAAATACACACATCAGTATGGAGTTCCTTAAAGTGCAACTTAAATCTGCTGTTGCCTTTTATGTTCATTAAACTAAATTGGCAAAGTAATTTTCTAACTATAATAAGAAGGTTTCTGAAGCTCACCAAGCATGAATTTATTTGGTGAAAATACAGTGAAAACAGTAATATTGTGAAATGTTATTACAGTTTTTAATAACTTGTATCTAGTATCTGATATCTTTACTGATAATGTAATGTATTTTATTTTGTCAATTTATTTGGAAGGAATTTCTGCAATGGTGGAGCTACCGAAGAACTTCATCGCAGCTGCCATGGATAAAGAGATTG[G/A]TAACACAGACACACATACTGTACATACATGCATAAATACATACACCGCAAAGATTTTTTCATAAATACTTAGATATTTTTGTCTTGTTTCTAATCCACAATCTAAAATATCTTAAATCTTGAAGCATTTTTCTAGTCAAGCAAAGTTTATTGTCTTGTTTTAGGGTGGGATTAGGGCAATACACAAAACAGTTTGTACAGTATAAAAACAATGGAAGCCTATGTAATGTGCCCACTTTTCAAAAAAACAAATGTGTGTGTGTGTACACAAGTGTGTACTCAGTGGCCATTTTATTAGGTACATCTTACTAGTACCAGGTTTGACCCCCTTTTGCCATCAGAACTGCCTTAATCATTTGTGGCATAGATTCAACAAGGTACTGGAAATATTCCTCAGAGATTTTGCTTCATATTGACATGATAGCATCACGCAGTTGCTGCAGATTTGTCGGCTGCACATGCATGATGCGAGTCTCTCATTCCACCACATCCCAAAGGTGC
Associated Phenotype:
Not determined