Busch Lab

ZMP

sgcd

Ensembl ID:
ENSDARG00000009789
ZFIN ID:
ZDB-GENE-030131-3684
Description:
delta-sarcoglycan [Source:RefSeq peptide;Acc:NP_001001816]
Human Orthologue:
SGCD
Human Description:
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) [Source:HGNC Symbol;Acc:10807]
Mouse Orthologue:
Sgcd
Mouse Description:
sarcoglycan, delta (dystrophin-associated glycoprotein) Gene [Source:MGI Symbol;Acc:MGI:1346525]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16337 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16337
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125386 Nonsense 99 292 3 8
Genomic Location (Zv9):
Chromosome 21 (position 34718781)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35713765
GRCz11 21 35760281
KASP Assay ID:
2261-5904.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGCGATTCGGAATTCCTTCAGCCGCTGTATGCCAAAGAAATCCAGTCC[A/T]GACCAGTAAGTGYACGACAGCACAGTGTTGAGGYGATAGCRGGGAGGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4957
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125386 Essential Splice Site 101 292 4 8
Genomic Location (Zv9):
Chromosome 21 (position 34708176)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35703160
GRCz11 21 35749676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGTAATCTTTCTAAACGCATTTTTTNNCTCCACTTTTTTTTTCATGTC[A/C]GGGAAGCCCATTGTTCCTGCAGTCATCTAAGAACGTGTCTGTCAACATCC
Associated Phenotype:
Not determined