Busch Lab

ZMP

ppa2

Ensembl ID:
ENSDARG00000009685
ZFIN ID:
ZDB-GENE-040426-1857
Description:
inorganic pyrophosphatase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_991225]
Human Orthologue:
PPA2
Human Description:
pyrophosphatase (inorganic) 2 [Source:HGNC Symbol;Acc:28883]
Mouse Orthologue:
Ppa2
Mouse Description:
pyrophosphatase (inorganic) 2 Gene [Source:MGI Symbol;Acc:MGI:1922026]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6589 Nonsense Mutation detected in F1 DNA Not yet available
sa24846 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6589
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023904 Nonsense 43 250 5 12
ENSDART00000123826 Nonsense 132 339 5 12
ENSDART00000142198 Nonsense 94 218 6 9
ENSDART00000145512 None None 112 None 6
ENSDART00000146312 Nonsense 94 282 5 10

The following transcripts of ENSDARG00000009685 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25277757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25701455
GRCz11 1 26395169
KASP Assay ID:
554-4869.1 (used for ordering genotyping assays)
KASP Sequence:
CAAAGGAACCATTAAACCCAATCAGGCAAGATGTAAAGAAAGGCAAGCTA[C/T]GATATGTAGCTAATGTTTTTCCACACAAAGGATACATTTGGAACTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24846
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023904 Nonsense 58 250 5 12
ENSDART00000123826 Nonsense 147 339 5 12
ENSDART00000142198 Nonsense 109 218 6 9
ENSDART00000145512 None None 112 None 6
ENSDART00000146312 Nonsense 109 282 5 10

The following transcripts of ENSDARG00000009685 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25277710)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25701408
GRCz11 1 26395122
KASP Assay ID:
554-7760.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACGATATGTAGCTAATGTTTTTCCACACAAAGGATACATTTGGAACTA[T/A]GGTGCACTTCCACAGGTGATGTTCTGTTTTTGCAAAAAAAAAAAAAAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25584
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023904 Essential Splice Site 92 250 6 12
ENSDART00000123826 Essential Splice Site 181 339 6 12
ENSDART00000142198 Essential Splice Site 143 218 7 9
ENSDART00000145512 None None 112 None 6
ENSDART00000146312 Essential Splice Site 143 282 6 10

The following transcripts of ENSDARG00000009685 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25277517)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25701215
GRCz11 1 26394929
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCTGTGGAGACAATGACCCAATAGATGTGTGCGAGATTGGCTCCAAG[G/A]TTGGTAAAATTGCATGGTTTAATGTGTAATGCAGTTTGTGTTTTACAAAA
Associated Phenotype:
Not determined