Busch Lab

ZMP

wu:fc13d03

Ensembl ID:
ENSDARG00000009610
ZFIN ID:
ZDB-GENE-030131-2614
Description:
Wu:fc13d03 protein [Source:UniProtKB/TrEMBL;Acc:A1L1W8]
Human Orthologues:
RGS10, RGS12
Human Descriptions:
regulator of G-protein signaling 10 [Source:HGNC Symbol;Acc:9992]
regulator of G-protein signaling 12 [Source:HGNC Symbol;Acc:9994]
Mouse Orthologues:
Rgs10, Rgs12
Mouse Descriptions:
regulator of G-protein signaling 12 Gene [Source:MGI Symbol;Acc:MGI:1918979]
regulator of G-protein signalling 10 Gene [Source:MGI Symbol;Acc:MGI:1915115]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45272 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11943 Essential Splice Site Available for shipment Available now
sa18866 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26919
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Nonsense 851 1370 8 17
Genomic Location (Zv9):
Chromosome 7 (position 19715553)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18248582
GRCz11 7 18500849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTACAGGAAAACAGGAAGCCCAAAACAGGCAGGTCAAGCGATGATCTC[A/T]GAGAGAAACACTCTGATAAGAAAAACGGCTTCTTTTCCTGGTACAGATAT
Long Flanking Sequence:
AATAATATATAATGTAATGCAATATATACTAGTCTCCAACATTTTGGCCACTACTTCCCACTGCTTAATTCCATGTTAGTTTCGCAAAATTCATGTGATGTATACTGAAATTTCTGTGTAGAGTTTGCATGTTCTCCCCGTGTTGGCGTGGGTTTCCTCCGGGTGCTCCGATTTTCCCCACAGTCTAAATATATGTGCTATAGGTGAATTGAATAAACTAATTTGTCTGTAGTGTATGAGTGTATGAGTGTGTATGGGTGTTTCCCAGTATTGGGTTGCGGCTGGAAGGGCTTCCGCTGTGTAAAACATGCCGGAATAGTTGGCGGTTCATTTAACTGTGGCGACCTCTAAAATAGAGAGTAAGCCGAAGAAAAATGAATGAATGAATGTATACTGAATTTTTCTAACCCAATTCACTGTTGTACTTTATTTTCTAACACTATGATGTTGTGTTACAGGAAAACAGGAAGCCCAAAACAGGCAGGTCAAGCGATGATCTC[A/T]GAGAGAAACACTCTGATAAGAAAAACGGCTTCTTTTCCTGGTACAGATATCCAAGTATTGGGAAAGGACAAAAGAAAAGAGAGGCCCCAGATTTACCCTACCGTGAGTCTCCTAATCTCATCAGCAATGATTTCCTTTCTTGCATATTCATTTAAATGAATGCTAAAATGAAAGATTTGCTATGTGGTTATCATGTGTTGACAGACTGTAATGGGCGGAGAGAGTCTCAAGGTTCTCTGTCTTCTGGAGCGAGTCAAGAGCTCAACACTTCCTGTTCAGGAGGAAAGAATGAGGTAAGAGGATTGGGACTTGCATAGGGGAACAGAGGAGTGCATTAGGGAGCTGCAGCAATAGATAGCCTAGGACCCAATGATTTCTGTGATGCAGAAAAATCTATCAGATTCAAATAGCAGAATCCATCTTAAAAACAGAACTAGCAGAATAACATCATGGAATTTCTTGAAAAAGTGATGTAAACCTAAACATAGTGTGCGGGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45272
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
Genomic Location (Zv9):
Chromosome 7 (position 19712790)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18245819
GRCz11 7 18498086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAG[G/A]TACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATT
Long Flanking Sequence:
GCACTAAGTTACATGAGCAAATTACCTCATTAACTTCAAGCTGCTTGCAGTTGTCAATGTCAATGTAACAAGCTAATTTTTTGTTTGTCCTTGTTTCTCATTTTCTTGTATGTGTAAAGCAGTGTGAGCTAAGAGGTTCGAGTTGTGCTTTGGATAAGGAGCGAGAGCGCTGCAGCAGGACATGTACAGTAACACTGCCCGACGGCTCCAGCTGCTCTATTCCTCTCCGACAGGGAGCCTCCATCAGACAAGTGCTGCTAGAGCTCTGCCAAAAACAACACATCAACCTGGCTGCTGTCGACCTCTTTCTCACCGGTGGAGAGAAGGTGCGCACAGCCTTCATTAGCTTTTATAGTGTCTCCTTTAGCGAGTCTGTCAGTGCTGAGCTTGATTTCTCTGTTTTTCTGCTTATTGTTTCTTTCTCAGCCTTTGGTCTTGGATCAAGATAGTATTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAG[G/A]TACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATTCCGTTTCGACTTTAACTTCAATTGGAAATGCTCTTCAGTATTGATCTGTTTCCTCCAAGAGCACCATATGTGACCTTGCACCACAAAACCGGTCTTTTTTTTTTTCTTTTGAAAATGAGACGCATACATCTGAATGAATATGATTGCATCTGATGTATGATAATACAGGATAATATTTAGCCAAGATGGTCACAACTATTAGAACTGAGAAATCCGAGAAAATCATCGTTCAATTGTATAACAGTTTACATTACTAATCAAAAATTGAGTTTTGATACATTTACAGTAGAAAATGCAGTACAAAATATCAGTACTGAATAATCGAATGGTTTTTGACATAAAAGAAAAATCCATTTTGATCCATTCAATGTATTTTCGGCCATTAACAAATTTCTGCTTTAAAATCATCTAAAAATAAGATTTTTCCCCCCAATTAATTAATAAATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11943
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
Genomic Location (Zv9):
Chromosome 7 (position 19712789)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18245818
GRCz11 7 18498085
KASP Assay ID:
2259-8610.1 (used for ordering genotyping assays)
KASP Sequence:
TTACTCTCAGCTCCAGGGAACTTCRTCTTGARAAGCGCACTTTGTTYAGG[T/C]ACGTTTTGTTATTATTATCTTCCTTTCGCAARCAATATCTGGAACTATTC
Long Flanking Sequence:
CACTAAGTTACATGAGCAAATTACCTCATTAACTTCAAGCTGCTTGCAGTTGTCAATGTCAATGTAACAAGCTAATTTTTTGTTTGTCCTTGTTTCTCATTTTCTTGTATGTGTAAAGCAGTGTGAGCTAAGAGGTTCGAGTTGTGCTTTGGATAAGGAGCGAGAGCGCTGCAGCAGGACATGTACAGTAACACTGCCCGACGGCTCCAGCTGCTCTATTCCTCTCCGACAGGGAGCCTCCATCAGACAAGTGCTGCTAGAGCTCTGCCAAAAACAACACATCAACCTGGCTGCTGTCGACCTCTTTCTCACCGGTGGAGAGAAGGTGCGCACAGCCTTCATTAGCTTTTATAGTGTCTCCTTTAGCGAGTCTGTCAGTGCTGAGCTTGATTTCTCTGTTTTTCTGCTTATTGTTTCTTTCTCAGCCTTTGGTCTTGGATCAAGATAGTATTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAGG[T/C]ACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATTCCGTTTCGACTTTAACTTCAATTGGAAATGCTCTTCAGTATTGATCTGTTTCCTCCAAGAGCACCATATGTGACCTTGCACCACAAAACCGGTCTTTTTTTTTTTCTTTTGAAAATGAGACGCATACATCTGAATGAATATGATTGCATCTGATGTATGATAATACAGGATAATATTTAGCCAAGATGGTCACAACTATTAGAACTGAGAAATCCGAGAAAATCATCGTTCAATTGTATAACAGTTTACATTACTAATCAAAAATTGAGTTTTGATACATTTACAGTAGAAAATGCAGTACAAAATATCAGTACTGAATAATCGAATGGTTTTTGACATAAAAGAAAAATCCATTTTGATCCATTCAATGTATTTTCGGCCATTAACAAATTTCTGCTTTAAAATCATCTAAAAATAAGATTTTTCCCCCCAATTAATTAATAAATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18866
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
Genomic Location (Zv9):
Chromosome 7 (position 19712789)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18245818
GRCz11 7 18498085
KASP Assay ID:
2259-8610.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAGG[T/C]ACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATTC
Long Flanking Sequence:
CACTAAGTTACATGAGCAAATTACCTCATTAACTTCAAGCTGCTTGCAGTTGTCAATGTCAATGTAACAAGCTAATTTTTTGTTTGTCCTTGTTTCTCATTTTCTTGTATGTGTAAAGCAGTGTGAGCTAAGAGGTTCGAGTTGTGCTTTGGATAAGGAGCGAGAGCGCTGCAGCAGGACATGTACAGTAACACTGCCCGACGGCTCCAGCTGCTCTATTCCTCTCCGACAGGGAGCCTCCATCAGACAAGTGCTGCTAGAGCTCTGCCAAAAACAACACATCAACCTGGCTGCTGTCGACCTCTTTCTCACCGGTGGAGAGAAGGTGCGCACAGCCTTCATTAGCTTTTATAGTGTCTCCTTTAGCGAGTCTGTCAGTGCTGAGCTTGATTTCTCTGTTTTTCTGCTTATTGTTTCTTTCTCAGCCTTTGGTCTTGGATCAAGATAGTATTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAGG[T/C]ACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATTCCGTTTCGACTTTAACTTCAATTGGAAATGCTCTTCAGTATTGATCTGTTTCCTCCAAGAGCACCATATGTGACCTTGCACCACAAAACCGGTCTTTTTTTTTTTCTTTTGAAAATGAGACGCATACATCTGAATGAATATGATTGCATCTGATGTATGATAATACAGGATAATATTTAGCCAAGATGGTCACAACTATTAGAACTGAGAAATCCGAGAAAATCATCGTTCAATTGTATAACAGTTTACATTACTAATCAAAAATTGAGTTTTGATACATTTACAGTAGAAAATGCAGTACAAAATATCAGTACTGAATAATCGAATGGTTTTTGACATAAAAGAAAAATCCATTTTGATCCATTCAATGTATTTTCGGCCATTAACAAATTTCTGCTTTAAAATCATCTAAAAATAAGATTTTTCCCCCCAATTAATTAATAAATAAATT
Associated Phenotype:
Not determined