Busch Lab

ZMP

LOC568543

Ensembl ID:
ENSDARG00000009568
Human Orthologue:
CA10
Human Description:
carbonic anhydrase X [Source:HGNC Symbol;Acc:1369]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6038 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa612 Nonsense Available for shipment Available now
sa20070 Essential Splice Site Available for shipment Available now
sa8624 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Essential Splice Site 45 326 3 9
Genomic Location (Zv9):
Chromosome 3 (position 35035990)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34821186
GRCz11 3 34950694
KASP Assay ID:
554-3968.1 (used for ordering genotyping assays)
KASP Sequence:
GTCTGCTGCTGAAATTTAAAGCTGMTGCTCTGAACTTTTTTCATTTTCAT[A/T]GTGCCGTCTTTCTGGGGACTARTTAACACTGCCTGGAATCTGTGCGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Nonsense 85 326 3 9
Genomic Location (Zv9):
Chromosome 3 (position 35036111)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34821307
GRCz11 3 34950815
KASP Assay ID:
554-0522.1 (used for ordering genotyping assays)
KASP Sequence:
TCAACATTGAAACCAGTCGCATGATTTTTGACCCCTTCCTCAACCCGCTA[C/T]GACTCAATGCAGGGCAACGCAAGGTAAGTGGTAAATCAGATGAAGCTCTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20070
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Essential Splice Site 93 326 4 9
Genomic Location (Zv9):
Chromosome 3 (position 35052696)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34837892
GRCz11 3 34967400
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCCAGAAGGCATCTAATCCTAAAAATAAATGTTTGGGTGTGTTTTTC[A/T]GGTCAGTGGAACGATGTATAACACGGGCCGGCATGTGTCACTGCGCCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8624
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055264 Nonsense 222 326 7 9
Genomic Location (Zv9):
Chromosome 3 (position 35061865)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34847061
GRCz11 3 34976569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAAYACTGTCTTTTCAGATGATGCATACTTATTGATGGGGCTGAATATT[G/T]AGGAGCTGTATCCCGAAACCTCACGGTTTATCACTTATGAAGGGTCGATT
Associated Phenotype:
Not determined