Busch Lab

ZMP

si:ch211-195m20.1

Ensembl ID:
ENSDARG00000009567
ZFIN ID:
ZDB-GENE-081104-517
Description:
Novel protein similar to SPEG complex locus (Speg) [Source:UniProtKB/TrEMBL;Acc:B0S5V2]
Human Orthologue:
SPEG
Human Description:
SPEG complex locus [Source:HGNC Symbol;Acc:16901]
Mouse Orthologue:
Speg
Mouse Description:
SPEG complex locus Gene [Source:MGI Symbol;Acc:MGI:109282]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa15486 Nonsense Available for shipment Available now
sa10121 Nonsense Available for shipment Available now
sa31739 Nonsense Available for shipment Available now
sa34720 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa15274 Essential Splice Site Available for shipment Available now
sa17142 Nonsense Available for shipment Available now
sa732 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 505 2702 3 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42688497)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41813667
GRCz11 9 41615454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TASWGGAGGGATACAACAGCAAATTAAWGTATTTTRTATACAGTTATATG[G/A]AAGAAAGACAACACTGAGGTCAAGAACAGTCCCACTCATGTTGTAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10121
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 995 2702 11 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42710308)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41835478
GRCz11 9 41637265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCACAGCCTGGTGGTCCGCTGTGTTTGTCATGCTCACGGAGGGGTTTA[C/A]AAGTGTGTCAKWTCCAATAAAGTGGGCAAGGCCACCTGCTATTCTCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31739
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 1057 2702 13 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42714263)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41839433
GRCz11 9 41641220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTCCAAAAAATCGTATTTATGTTTCCAGACCCCAGCTCCCTGATGTA[T/A]GCCATTCAGCAACAGGCCCTGGGGTCGATCCAGTGGACCATCATCGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34720
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Splice Site, Nonsense 1314 2702 18 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42721597)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41846767
GRCz11 9 41648554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTCTGATCAAGCAAATCTTACCCATTTTTGAATTTCTCCACATAGCC[A/T]AACAGTACAAAGACGACCCGATGGAGGATGAGGCGTCCATCCTCAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15274
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Essential Splice Site 1413 2702 20 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42725179)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41850349
GRCz11 9 41652136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATGAGTTGATTTTCTCCATCACTGTGATTGTCTTTGACAACATGCAAA[G/A]ATGCCATGAGGAGCTTCTCGATAGGCTTACAAAGAAATCAACCATCTTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1102
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 2065 2702 26 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42731429)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41856599
GRCz11 9 41658386
KASP Assay ID:
554-1004.1 (used for ordering genotyping assays)
KASP Sequence:
GARAAGATGAGGAGCCAGAGAAAGAAACTGAGCCTCCTACTCCAAARATT[G/T]AGGTTAAGGAATATGAGGGTGATGTAAAGGTATTACCAAAGTCYCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17142
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 2270 2702 26 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42732044)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41857214
GRCz11 9 41659001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGTTTCKCATTTCAGAAGACTGAAGACAAGYCYTCCACTGTTTCTCCT[G/T]AAACTGCWGAAGAAMTGTATCRCCCTGGACCAACTGGTGCTCCTTTAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27454
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Nonsense 2333 2702 26 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42732233)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41857403
GRCz11 9 41659190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGCGCTTGAAAAGGACCCCATCAGTGGAAAAGCAGGAGGAGAAGCTC[A/T]AAGAGGAGGAGGCTTCAGCACCCAGGCGTCGTCTTTCTTGGGCACTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa732
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 Essential Splice Site 2512 2702 27 31
ENSDART00000138473 None None 366 None 6
Genomic Location (Zv9):
Chromosome 9 (position 42732849)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41858019
GRCz11 9 41659806
KASP Assay ID:
554-0639.1 (used for ordering genotyping assays)
KASP Sequence:
AAGACAGTTTCCCAACCAGACATCCCAGCTTCCATTGCTAGAGAGAATGG[T/C]TCTCTACGRTCTCGCCAATATACACGTCTAACATCTGGTACTGCACATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8352
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 None None 2702 None 31
ENSDART00000138473 Nonsense 19 366 1 6
ENSDART00000059586 None None 2702 None 31
ENSDART00000138473 Nonsense 19 366 1 6
Genomic Location (Zv9):
Chromosome 9 (position 42742597)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41867767
GRCz11 9 41669554
KASP Assay ID:
2260-2271.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTGGTTACAAGTCTGAGTCCTGTAGGGGAGGGAACTGGGACACCCAAT[C/T]GAATGACCCCTAGTGGAAGAGCCACGCCTTCTGGACGCATCACTCCATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18962
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059586 None None 2702 None 31
ENSDART00000138473 Nonsense 19 366 1 6
ENSDART00000059586 None None 2702 None 31
ENSDART00000138473 Nonsense 19 366 1 6
Genomic Location (Zv9):
Chromosome 9 (position 42742597)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41867767
GRCz11 9 41669554
KASP Assay ID:
2260-2271.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGGTTACAAGTCTGAGTCCTGTAGGGGAGGGAACTGGGACACCCAAT[C/T]GAATGACCCCTAGTGGAAGAGCCACGCCTTCTGGACGCATCACTCCATCA
Associated Phenotype:
Not determined