Busch Lab

ZMP

foxi3b

Ensembl ID:
ENSDARG00000009550
ZFIN ID:
ZDB-GENE-031126-4
Description:
forkhead box protein I1 [Source:RefSeq peptide;Acc:NP_944600]
Human Orthologue:
FOXI1
Human Description:
forkhead box I1 [Source:HGNC Symbol;Acc:3815]
Mouse Orthologue:
Foxi1
Mouse Description:
forkhead box I1 Gene [Source:MGI Symbol;Acc:MGI:1096329]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22519 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa222
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024440 Nonsense 157 383 1 2
Genomic Location (Zv9):
Chromosome 14 (position 35645383)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34174660
GRCz11 14 34514974
KASP Assay ID:
554-0124.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGCTATACATGGTGCCCCAGAACGCCGCCTGACCCTCAGTCAGATTTA[T/G]CAGTATGTTGCAGACAATTTCCCTTTCTACAACAAGAGCAAAGCAGGATG
Long Flanking Sequence:
TGCCAACTGGAGCACCCTCAGGATCGAGCAATGACATCCTACGAGTCTCAAGGTCAGTCTCCGACAAGATGTGGGCCTCAGTTCCCTAGCCTAGGACAGGAACCTCCAGAACTGAGTCTGTACAGCGACAGCTACTATCCGCCTCCATCCCTTCCAAGTCCACAAAGAACCAACCCGTCTTCATACGAACTTGGAGACTATGCCGCCTCCTCACCTAACCCCTACCTGTGGTTCAACAGTCCAGGAATGAACAGCGCTCCTTATCTGGGAGGAACGCCTGGCCCTGCTGGACCTTCTTTCGTTCCCCAGCACTACGGCATGCAGAGGCCCTATTTAGGACCTGGGCCACCAGGTGGTCCTGGAGGGGAATTGAGCTGGTTCTCCATGCCGTCTCAGGAGGATCTAATGAAGCTGGTCAGGCCACCGTATTCATACTCCGCTCTTATTGCGATGGCTATACATGGTGCCCCAGAACGCCGCCTGACCCTCAGTCAGATTTA[T/G]CAGTATGTTGCAGACAATTTCCCTTTCTACAACAAGAGCAAAGCAGGATGGCAAAACTCAATTCGACACAACCTCTCACTCAATGACTGTTTCAAAAAAGTTCCACGAGATGAAGATGATCCAGGTGAGTGTTTTTTGTTTTGCTTATTGTTTATTTATTAAATTAAGATAAAATCTCTCAAAGACAATACAAATAATAGTGAGTTTTATTTAAATATGTATATATTTTTATTATTAGATATTAAAATATGATGTAAAATAATTACAAAAATGTCTATTTTTAGAGTTAGACATTCTATATATATATATATATATATATATATATATATATATATATATATACAATGTATTATATAATATAAATAAATAAATAAATTGTAATTTTTACACTATTAATAATTCATAGCAAATTAACAAATATAATATATTTTTAAAATAAATCATATAATCATTTATTTATCATGCTACTCTTTTCAATCTTTTTTACTTTTTTAATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024440 Nonsense 371 383 2 2
Genomic Location (Zv9):
Chromosome 14 (position 35646411)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34175688
GRCz11 14 34516002
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGACCTGTTCTCAGTCAGTTTAATGGCCATTTCTTCCCTGGTTTGAGCT[C/A]AACGGGTATTCTTTACCCTCGGGAAGGCACAGAGGTGTAGGATGGGAAGC
Long Flanking Sequence:
GACCTTAGATCCGAATTGTGAAAAAATGTTTGACAATGGCAACTTCAGACGCAAGAGAAAGAGAAAGTCTGACAGTCTCCCAGAGAAAAGCAGTTCTGGAGGGAATGAGTCAGGAGACAGTAATGGCAGGGGTAGCCCGAAAAGTCAATCCATTGACATTTCCACTTCACCAGAAAAGGGCCCATCACCCGCATCCACGGGTCCATCGCCATGCTTGAGCAACTTCCTGACTGAGATGTCTGGAGTTGCGGCCGGATCTCTTGACATGGAAGCGGATCCCCTGAGTCGCCCCTTTACACTCAGTCTGCCAGTAGACGGGGCACAGAGAGCTTCACAAACCACAGGTTTTTCCACCTTCACTCCAAGCACTACGGTGTCCGATTGGGCTTCACCTCTGCCCCCACCGCCACCCATGTCCTCGTCACCCTCCCACTCCACGTTAGCTTACAGCGGACCTGTTCTCAGTCAGTTTAATGGCCATTTCTTCCCTGGTTTGAGCT[C/A]AACGGGTATTCTTTACCCTCGGGAAGGCACAGAGGTGTAGGATGGGAAGCAGACGACAGACAAGCTGATCAACCAATTCATGTTACTGACTATGGGGGTAAGAAAAAACACTGTTGTTTTCCTGAAACTATACACTGCTATTGGCCTAACTGAACTCCTTTGAGTTCTGTGGGCACAAGATACGAATGAATTCCCACAGGAATAGCCTAGTCAGCAGCAGATATGACAGGCTGACTCCAGCAAAAGGCCCCTGCTACCAGCAGCTCTGACCCGAGGTCAGCTGCTGACATCAAGCCATTCTACACACCCATCTCATTCCTAACTCATATTACTGTCACTGACTGCAAACACCTGTAACGAAACTGAGCAGATAAGCAGAGAAAATGCATATGGTGTAGCAGATTTTCTTCTTTTGCTGCATGCTGGTGTTGTCATATGATCCTGTCTGCCTTTGTATTTTAACATGACTAATTTTGTTTATGTATATTTGTTGTATGTGT
Associated Phenotype:
Not determined