Busch Lab

ZMP

wls

Ensembl ID:
ENSDARG00000009534
ZFIN IDs:
ZDB-GENE-040426-2161, ZDB-GENE-040426-2161
Description:
G protein-coupled receptor 177 [Source:RefSeq peptide;Acc:NP_998311]
Human Orthologue:
WLS
Human Description:
wntless homolog (Drosophila) [Source:HGNC Symbol;Acc:30238]
Mouse Orthologue:
Wls
Mouse Description:
wntless homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915401]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25762 Nonsense Mutation detected in F1 DNA Not yet available
sa39773 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016369 Nonsense 196 542 4 12
ENSDART00000130302 Nonsense 196 542 4 13
Genomic Location (Zv9):
Chromosome 2 (position 10152622)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10577718
GRCz11 2 10361317
KASP Assay ID:
2259-1624.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGACCTGTTGCCCTTTATGGAGCTTGGCAGTGTGGCCCATAAGTACTA[T/A]CTTCTCAATGTCCGACTGCCTGTTAATGAACGAAAAAAGGTCAACATCGG
Long Flanking Sequence:
TGAGGAATGTGTTTAGGGGTTGAGAGCAATGGTATTAGCATTGAAGCTTGTAGTATCCTTGTTTTTGTGTACTTGCATAATGGAGCACAGTAAACTACTCTACAGTGCAGCAACGTTTACTGTTTAAAGTGCATTAACTTTAAGACCTGTGTTTTGTGTTGTCCTGTAGCGGATGGAGCTTCGATCACCATTGATGTCAGGCTGGCCTACAGAGACGACAAACTGAGCGAGTGGACACAGATGGCCCATTCCGTAGAGCAACGCAAACTCAGCTGCAATTTCACTGCAGCAAAGGTAAATGATCAACTCCATTCTATGTAATTAGGCACTAAATAGGGTACTAGTGGAATCGATTAAAATCTGGTTGTGGTTTTTTTTTTAAACTTTGAAAACTTCAGTTGCTTTATTTTGAATTTGCAGACTATAGAAAATGAGGGTCGCCTCTATGATTGTGACCTGTTGCCCTTTATGGAGCTTGGCAGTGTGGCCCATAAGTACTA[T/A]CTTCTCAATGTCCGACTGCCTGTTAATGAACGAAAAAAGGTCAACATCGGGATTGGAGAAATCAACGACATGCGTCTTGTGGTGAGTCTTCAGAGTGTGACTTTGATGAATAACCTTTTAGGATGCATGTCTAAAACGCACAGCTATGTAGTCGGTTTTGTTTGAGCTTTGTTTGCCTGGGAGGATTTTGGCTAGTCTCGTCTTGTTATAATTGGCACACGCTTCAGGACAGGGCAATGGTTATACAAATGTCAGTGGACCAAGGACATCTGGATTGCATCATGACTTAATCTTCGCCTTTGTTTGGATTACTCCTCTTATTTGACTCTTAGCAAACAACGATACCCATCAATTAAGTGTGCTTAATGTGTTTCTCATTGTCACTGTAACTCTTCAGGGCATTCATCAAAATGGTGGCTTCACCAAGGTTTGGTTTGCCATGAAGACGTTCCTCACTCCCAGCGTCCTTATTATTATGATCTGGTACTGGAAGAGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39773
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016369 Essential Splice Site 325 542 6 12
ENSDART00000130302 Essential Splice Site 325 542 6 13
Genomic Location (Zv9):
Chromosome 2 (position 10145887)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10570983
GRCz11 2 10354582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCATGCTGCTCTCCTTCTGGATCATCTTCTGTGGAGAGCACCTCATGG[T/C]AAGTGCCAGCTTTCTTGTTTGTTCAAATGTGGATCAATTGGTGCAGAATT
Long Flanking Sequence:
TGCACTTCCTTACCCTCACCAGAGTTGACCTCATGGACATTCCTTGCATTCCAACCCAATATGGTCTTTTTCTGCCACATTGAGCCAGGCGGGAATGTGATTCATGTGTTTGAAGTTACATTCCACACCCCATCTCAGTCTCACCGAATGGGCCGTATAATAGCTTGTCCCAGCATGCCTGCCTTTGAACACTAGAGAACAGAGAGATTTGGTTTGACCTTTTTCAAGGCTTTGGTTCTGTCCTCTTAGTTATATCTTGCTATTAGTGTAATGTTTCTTGGTGAGGTGTGCTAGCAATTATTATACTCTGTACACTGCGTCCTCTTTTAGGGTCATCTTCGCTCTGGGAATCTCCATGACCTTCATAAATATCCCAGTGGAGTGGTTCTCTGTGGGCTTTGACTGGACCTGGATGCTGCTGTTTGGTGACATCCGTCAGGGCATCTTCTACGCCATGCTGCTCTCCTTCTGGATCATCTTCTGTGGAGAGCACCTCATGG[T/C]AAGTGCCAGCTTTCTTGTTTGTTCAAATGTGGATCAATTGGTGCAGAATTACTTTAAACTTTTGTCTTAAAATAAACAATTCTGTCGGAGCCTTTGAGATCTGTACTTTGTTAATACAATTCCCTTGATCTCTTTTCAACTGTCCTATCTTAATGAAGGGAAAAATACACTCTGTCACTTTACTTGGTTAGAAATGGTTTGGACTAATTTTTACCATTATGGCTGCCTTTTTAATTCAAGTCAATAAAAAAATAAAAAAAAATAATTAATCAGAGTTTTAAGATCCATATTGAAATGAAAGCATCATGCTATTGCTGCAGATCCACAATGTAAATCTCGCCTTCCTGCACATCCCAAATCAGATTGAGATATTGGATTGAGATCTGGTGACTGCTACCATTTAAGTATAGTCAACTCATTGTCATGTCCGTGATGATTTGTTTTCCTGCTGGACATAACAGTTAAGATGGTCACACTGTAATCATCAACAACATACGGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3414
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016369 Essential Splice Site 427 542 9 12
ENSDART00000130302 Essential Splice Site 427 542 9 13
Genomic Location (Zv9):
Chromosome 2 (position 10142696)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10567792
GRCz11 2 10351391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGTCGTGTTTGCCTGCTATGACTAAGGCTCSTCRACTGCACTATGAGG[T/G]AATGTAAACTTGATTTATTGCACAWTAAATTRGTCAAAAGTGATGCAGAA
Long Flanking Sequence:
GGGACAGAACTGGCTGTATCCTTTTGACGCTGTGGGCTTTTCAACTTTCTGTAATGAGAAACGTTACAGCAGCTCATTTGCATATAAAGAGACACACAATTATATATATTTTTGCTTCTACCTCAAAATGGGCATTTACATCACAAAATGTTATTTAAAGGTATAATAGGATTTTTTTTGTTTTCAGTTATGCATTTCATATGTACCACACATGTTCACTCTTAACATACTAAAGGCTTAGACTTAAGTATGATTTCCAGGAAAATGTCAAGACCATACTATTGTGATGGTTGCTGTGCTGTTGTGTTGTAGTGTATTGTGCATTGTTTTATTACTTTAACTGGGGTTGGTGCAGATGGCCTTCATCATTGTCGCAGGAATCTGTGCATGCCTCTACTTTTTGTTCCTGTGCTTCATGGTGTTCCAAGTGTTCAGGAACATCAGCGGGAAAAGGTCGTGTTTGCCTGCTATGACTAAGGCTCGTCGACTGCACTATGAGG[T/G]AATGTAAACTTGATTTATTGCACAATAAATTAGTCAAAAGTGATGCAGAAGGCATTTGTTACAAAATAATTGATTCGATTCAATTCAATTCAATTCAATTTTGTCCATTAGAAAACTCTACAACAAATGTATCATGATTTTCACAAAAAGGTTAAGCAGTATAACTGTAACACTTATAATAATAATAATAATATAAAATATTCTATGATTTTGAATTTTCATCAAAGGAATAAAATTTAATTTTAAAATGTATGTATTAAGTCATTAAAACTTTTTTTAATCAAAATTACAGTAAATAAGTACTACTTTCAAGAATTCATACGGTCATGGAAAACCTTTAAAAGTCATGGAATTTTGACATGGCATTTTCCAGGCCTGTAATTGTTTTGGAAAAACATAAAAATCACAAAGTTTTGAAAAGTCATGTAAATCAGTTTAATTAATATCTGTATAATTGAATTAGGGCTGCACGATATTGGAAAAATATTGGATATTGGATA
Associated Phenotype:
Not determined