Busch Lab

ZMP

slmo2

Ensembl ID:
ENSDARG00000009505
ZFIN IDs:
ZDB-GENE-031002-13, ZDB-GENE-031002-13
Description:
protein slowmo homolog 2 [Source:RefSeq peptide;Acc:NP_956028]
Human Orthologue:
SLMO2
Human Description:
slowmo homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:15892]
Mouse Orthologue:
Slmo2
Mouse Description:
slowmo homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913640]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26859
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008243 Essential Splice Site 67 193 2 6
ENSDART00000125527 Essential Splice Site 67 193 2 7
Genomic Location (Zv9):
Chromosome 6 (position 59779385)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 60120503
GRCz11 6 60115426
KASP Assay ID:
2259-8317.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCGTCTACTCAGCACTGAATGGGGTCTGCCGTCCATCGTCAGATCGG[T/C]ACACAATTCCTCCTTTCTTCTAGATGACACACTTTAATCTGCTCGTTTGC
Associated Phenotype:
Not determined