Busch Lab

ZMP

NP_001138287.1

Ensembl ID:
ENSDARG00000009482
Description:
solute carrier family 38, member 8 [Source:RefSeq peptide;Acc:NP_001138287]
Human Orthologue:
SLC38A8
Human Description:
solute carrier family 38, member 8 [Source:HGNC Symbol;Acc:32434]
Mouse Orthologue:
Slc38a8
Mouse Description:
solute carrier family 38, member 8 Gene [Source:MGI Symbol;Acc:MGI:2685433]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23296 Essential Splice Site Available for shipment Available now
sa16369 Nonsense Available for shipment Available now
sa16166 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19201
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Essential Splice Site 182 441 4 11
ENSDART00000100857 Essential Splice Site 182 441 4 11
Genomic Location (Zv9):
Chromosome 18 (position 21414674)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21644897
GRCz11 18 21633963
KASP Assay ID:
2261-2174.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAGTGTTTATTTTCTCCTCAGTCGTCTTTGATATTTATTTTTCCTCA[G/A]TGTTCTAGGAACTTTTGCTGCCGCATATCTGACTGTGGCCATCGTTGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4032
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Essential Splice Site 182 441 4 11
ENSDART00000100857 Essential Splice Site 182 441 4 11
Genomic Location (Zv9):
Chromosome 18 (position 21414674)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21644897
GRCz11 18 21633963
KASP Assay ID:
2261-2174.1 (used for ordering genotyping assays)
KASP Sequence:
CACCAGTGTTTATTTTCTCCTCAGTCGTCTTTGATATTTATTTTTSCTCA[G/A]TGTTCTAGGAACTTTTGCTGCCGCATATCTGACTGTGGCCATCGTTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23296
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Essential Splice Site 274 441 6 11
Genomic Location (Zv9):
Chromosome 18 (position 21410554)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21640777
GRCz11 18 21629843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTCGGTGTTGTCCATGCTCATCTGCCTGCTCATCTACTCGCTCACAG[G/A]TCAGTAATGATCATATACTGAAACACAAAGATTGCTTTTAATCAAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Nonsense 311 441 7 11
ENSDART00000100857 Nonsense 311 441 7 11
Genomic Location (Zv9):
Chromosome 18 (position 21406154)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21636377
GRCz11 18 21625443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YAGTGGTGGTGATGTCACCATGAKTGTCGCCAGGCTTCTGTTTGGAATCT[C/A]AATTATCACCATCTACCCCATCATCGTCCTGCTTGGAAGGTCTGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16166
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100857 Nonsense 311 441 7 11
ENSDART00000100857 Nonsense 311 441 7 11
Genomic Location (Zv9):
Chromosome 18 (position 21406154)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21636377
GRCz11 18 21625443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YAGTGGTGGTGATGTCACCATGAKTGTCGCCAGGCTTCTGTTTGGAATCT[C/A]AATTATCACCATCTACCCCATCATCGTCCTGCTTGGAAGGTCTGAAACCA
Associated Phenotype:
Not determined