Busch Lab

ZMP

ppardb

Ensembl ID:
ENSDARG00000009473
ZFIN ID:
ZDB-GENE-000112-47
Description:
peroxisome proliferator-activated receptor delta b [Source:RefSeq peptide;Acc:NP_571543]
Human Orthologue:
PPARD
Human Description:
peroxisome proliferator-activated receptor delta [Source:HGNC Symbol;Acc:9235]
Mouse Orthologue:
Ppard
Mouse Description:
peroxisome proliferator activator receptor delta Gene [Source:MGI Symbol;Acc:MGI:101884]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34394 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41198 Nonsense Mutation detected in F1 DNA Not yet available
sa2434 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa34394
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013214 Essential Splice Site 24 367 3 7
ENSDART00000128783 Essential Splice Site 174 517 3 7
ENSDART00000132584 Essential Splice Site 174 517 4 8
ENSDART00000135394 Essential Splice Site 174 219 4 4
ENSDART00000141099 None None 120 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24567850)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23693668
GRCz11 8 23714907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCATGTGTGCCTTTCCGTTTTTCAGTGAGGATGTCATTTGTGTTTAAA[G/A]GGTTTTTTCAGGCGCACCATTCGTATGAAGTTGGAGTACGAGCGATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41198
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013214 Nonsense 36 367 3 7
ENSDART00000128783 Nonsense 186 517 3 7
ENSDART00000132584 Nonsense 186 517 4 8
ENSDART00000135394 Nonsense 186 219 4 4
ENSDART00000141099 None None 120 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24567889)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23693707
GRCz11 8 23714946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTAAAGGGTTTTTTCAGGCGCACCATTCGTATGAAGTTGGAGTA[C/A]GAGCGATGTGAGCGCGCCTGTAAAGTCCAGAAAAAGAGCCGGAACAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2434
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013214 Nonsense 248 367 6 7
ENSDART00000128783 Nonsense 398 517 6 7
ENSDART00000132584 Nonsense 398 517 7 8
ENSDART00000135394 None None 219 None 4
ENSDART00000141099 None None 120 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24573570)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23699388
GRCz11 8 23720627
KASP Assay ID:
554-2941.1 (used for ordering genotyping assays)
KASP Sequence:
TGGCCAATGGGAAGGGTTTTGTGACGAGAGAGTTTCTGCGAAGTTTACGC[A/T]AGCCATTCAGTGAGATCATGGAGCCCAAGTTTGAGTTTGCAGTGAAATTC
Associated Phenotype:
Not determined