Busch Lab

ZMP

si:ch211-222n4.6

Ensembl ID:
ENSDARG00000009386
ZFIN ID:
ZDB-GENE-091118-7
Human Orthologue:
MPP4
Human Description:
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) [Source:HGNC Symbol;Acc:13680]
Mouse Orthologue:
Mpp4
Mouse Description:
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) Gene [Source:MGI Symbol;Acc:MGI:238

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa16012 Essential Splice Site Available for shipment Available now
sa15310 Nonsense Available for shipment Available now
sa29558 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16012
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Essential Splice Site 92 641 3 25
ENSDART00000144086 Essential Splice Site 89 331 3 11
ENSDART00000147246 None None 263 None 6
Genomic Location (Zv9):
Chromosome 21 (position 17807697)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18955949
GRCz11 21 18992585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGGTCCAGCCAGGYCATATGTCTCATATTCAWCTGGACTTTCTCTRCAG[G/A]TTAGCTTTAAAGTTTATTGGCATANTTTTTTAACCAGTTTGTTCCACTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29560
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 None None 641 None 25
ENSDART00000144086 Essential Splice Site 311 331 11 11
ENSDART00000147246 None None 263 None 6
Genomic Location (Zv9):
Chromosome 21 (position 17800868)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18949120
GRCz11 21 18985756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAATGATTAGCTAATGATGTGCCAAGATACCATAATATTCTGGTTAAGG[C/A]ACAAAACTCTGTCTTCTTACTACAGAAGATGACATGATTGCCATAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15310
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Nonsense 388 641 20 25
ENSDART00000144086 None None 331 None 11
ENSDART00000147246 Nonsense 10 263 1 6
Genomic Location (Zv9):
Chromosome 21 (position 17797421)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18945673
GRCz11 21 18982309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CRATGTTTCCTTGTCATATTAGCTGGATTTCGTAGWAGTTTGCGTCTCTG[T/A]CGCCGGCGAAGGGSTCAGGCTTTCGGAAYGTCTCARTTCTGCTCCSTTYG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29559
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Essential Splice Site 438 641 20 25
ENSDART00000144086 None None 331 None 11
ENSDART00000147246 Essential Splice Site 60 263 1 6
Genomic Location (Zv9):
Chromosome 21 (position 17797269)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18945521
GRCz11 21 18982157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGATACCAACACCATCCAGAACACACACACCGCCTCATAGCACTGATAG[G/A]TGAGTGTGTCTGAAGAGCTCTTCATAGTTCTATTAGTGGGTATCTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29558
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Essential Splice Site 439 641 None 25
ENSDART00000144086 None None 331 None 11
ENSDART00000147246 Essential Splice Site 61 263 None 6
Genomic Location (Zv9):
Chromosome 21 (position 17797268)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18945520
GRCz11 21 18982156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGATACCAACACCATCCAGAACACACACACCGCCTCATAGCACTGATAGG[T/C]GAGTGTGTCTGAAGAGCTCTTCATAGTTCTATTAGTGGGTATCTAAAGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4943
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Essential Splice Site 497 641 22 25
ENSDART00000144086 None None 331 None 11
ENSDART00000147246 Essential Splice Site 119 263 3 6
Genomic Location (Zv9):
Chromosome 21 (position 17795108)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18943360
GRCz11 21 18979996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCATTTCGTCAGCCGAGAGCAGTTCGACAGCATGGTGTGCAATCACAGG[T/C]GCTGGAATACACATACCGTTGAAGTCAGAATTATCAGCCCTYCTGTRTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23899
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Nonsense 572 641 24 25
ENSDART00000144086 None None 331 None 11
ENSDART00000147246 Nonsense 194 263 5 6
Genomic Location (Zv9):
Chromosome 21 (position 17793365)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18941617
GRCz11 21 18978253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAGATGAAGCGCACTCGGATGAACTCCAATATCATCACAAATTACTA[T/G]ACAAGCCGACCTTTTAGGGTAACTGTTCATCTTTACCTTTGCCTACTGAT
Associated Phenotype:
Not determined