Busch Lab

ZMP

zgc:77593

Ensembl ID:
ENSDARG00000009299
ZFIN IDs:
ZDB-GENE-040426-1842, ZDB-GENE-040426-1842
Description:
dual specificity protein phosphatase 8 [Source:RefSeq peptide;Acc:NP_957174]
Human Orthologue:
DUSP8
Human Description:
dual specificity phosphatase 8 [Source:HGNC Symbol;Acc:3074]
Mouse Orthologue:
Dusp8
Mouse Description:
dual specificity phosphatase 8 Gene [Source:MGI Symbol;Acc:MGI:106626]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa866 Nonsense Available for shipment Available now
sa38077 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa866
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024633 Nonsense 74 629 2 7
ENSDART00000122781 Nonsense 74 629 1 6
Genomic Location (Zv9):
Chromosome 25 (position 23753661)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22932774
GRCz11 25 23030322
KASP Assay ID:
554-0768.1 (used for ordering genotyping assays)
KASP Sequence:
GGAGGCTTCAGCAGGACAAGGTGTCGGTTACCGAGCTCCTCCAACCCAAC[G/T]GAAAGGTCAAGGTATCAAGTGTGTGTGTCTGAAGGAGTGTGTGGGTAGTT
Long Flanking Sequence:
TTTTTAAAACTACTTAATAAATTACAATTCCTGTGAAAAACGACTCAATAACAGTAATTTGAGTATTTGCATATTGTTACTTTACACCACTGTTGTTGACAAAGTACTCTCTAAAATAAAACAATTAAAAAATTGTTCCTTTGTTTTTTTTCTCCAGACACCATGTGCACCTTGATGTCTCTTGGTGGCCCGTGGCAGTGATTTAATCACTGATTCACCACCTCTGCCTTGATTGTGGTTGTGAGCACCCCCTCATCCAGAGAGGGCTTCTGGGAGTCTCCATGGCGGGGGAGAAGAGCCGTCGCAGTGCCATGGACATCAAGCGTCTGGCAGGCCTGCTGCAGCGGGGAGCCGGACGACTGCTGGTCATAGACAGTCGAACATTCTCGGAGTACAATGCCTCGCATGTGCATGGTGCCATCAATGTTTGCTGCTCCAAGCTGGTCAAGAGGAGGCTTCAGCAGGACAAGGTGTCGGTTACCGAGCTCCTCCAACCCAAC[G/T]GAAAGGTCAAGGTATCAAGTGTGTGTGTCTGAAGGAGTGTGTGGGTAGTTTATGTAACTGAGAATTGAGGGTGGCATCAAAAAGGTTGATGTCGGCAAGCGGACAGCTGCAAGCTTTTGAAGGGGTTGGTTTACAATGCTGGACTTCACAAGCATGTCGCTTCGCAATATTAAAATCAAGTAATGTTTGCTTGTGAACATCCATTAAAGAGTCCCCGATTTTGGCACCAGCTTGCAAGATCTGCTGTCAAATTCTTATGCACGCACAGTATTTGACACCTCTTCATCTAAAATGATTTTGTAATTAGGTGTAGTAGTCGACGGTCAGTTTGAAGTCAAAGAGTCTAGATCAGGGGTCTTGATGTTTTCTAACTCGCAGCTATCCTTGCTTCCTCATTCGTAAATTTAGAAAACCAGTGCAGGTTTATTGGTTATCTGAAATAGGAGACTCGAGTTTTCCATGACTTCTACATTGAATATGACATAATTTTTTCTTCTCGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024633 Essential Splice Site 77 629 2 7
ENSDART00000122781 Essential Splice Site 77 629 1 6
Genomic Location (Zv9):
Chromosome 25 (position 23753649)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22932762
GRCz11 25 23030310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGACAAGGTGTCGGTTACCGAGCTCCTCCAACCCAACGGAAAGGTCAAG[G/A]TATCAAGTGTGTGTGTCTGAAGGAGTGTGTGGGTAGTTTATGTAACTGAG
Long Flanking Sequence:
CTTAATAAATTACAATTCCTGTGAAAAACGACTCAATAACAGTAATTTGAGTATTTGCATATTGTTACTTTACACCACTGTTGTTGACAAAGTACTCTCTAAAATAAAACAATTAAAAAATTGTTCCTTTGTTTTTTTTCTCCAGACACCATGTGCACCTTGATGTCTCTTGGTGGCCCGTGGCAGTGATTTAATCACTGATTCACCACCTCTGCCTTGATTGTGGTTGTGAGCACCCCCTCATCCAGAGAGGGCTTCTGGGAGTCTCCATGGCGGGGGAGAAGAGCCGTCGCAGTGCCATGGACATCAAGCGTCTGGCAGGCCTGCTGCAGCGGGGAGCCGGACGACTGCTGGTCATAGACAGTCGAACATTCTCGGAGTACAATGCCTCGCATGTGCATGGTGCCATCAATGTTTGCTGCTCCAAGCTGGTCAAGAGGAGGCTTCAGCAGGACAAGGTGTCGGTTACCGAGCTCCTCCAACCCAACGGAAAGGTCAAG[G/A]TATCAAGTGTGTGTGTCTGAAGGAGTGTGTGGGTAGTTTATGTAACTGAGAATTGAGGGTGGCATCAAAAAGGTTGATGTCGGCAAGCGGACAGCTGCAAGCTTTTGAAGGGGTTGGTTTACAATGCTGGACTTCACAAGCATGTCGCTTCGCAATATTAAAATCAAGTAATGTTTGCTTGTGAACATCCATTAAAGAGTCCCCGATTTTGGCACCAGCTTGCAAGATCTGCTGTCAAATTCTTATGCACGCACAGTATTTGACACCTCTTCATCTAAAATGATTTTGTAATTAGGTGTAGTAGTCGACGGTCAGTTTGAAGTCAAAGAGTCTAGATCAGGGGTCTTGATGTTTTCTAACTCGCAGCTATCCTTGCTTCCTCATTCGTAAATTTAGAAAACCAGTGCAGGTTTATTGGTTATCTGAAATAGGAGACTCGAGTTTTCCATGACTTCTACATTGAATATGACATAATTTTTTCTTCTCGACTGGCATGCCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30260
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024633 Essential Splice Site 274 629 6 7
ENSDART00000122781 Essential Splice Site 274 629 5 6
Genomic Location (Zv9):
Chromosome 25 (position 23705529)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22884642
GRCz11 25 22982190
KASP Assay ID:
2261-9728.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTTATATTATGAAGACAATGGGCTTGTCATCAGATGACGCTTATAGG[T/C]AAACTCACTCAGACACCCTGCAGCTTAGATTGCACAGTCTTAGAAAGATA
Long Flanking Sequence:
TACGACTGCTCATTACTGACATCTTAGAATGTTAGAGTTCATATTTTATATCTTAATTCTTTGCTCCCTCAGGATCTGATGGCTCAAAACGGCATCACATATGTGTTAAATGCAAGCAACACCTGCCCAAAACCAGAGTTTATCTCCGAAAGCCATTTCATGCGCATTCCCGTCAATGACAACTACTGTGAAAAACTCCTGCCATGGCTCGACAAAACAAATGAGTTCATTGGTAAGAAAATGCTTGCTTCAGTACCTTAAATGTTGATTATATTTTCCCTTTGCTACTTTCTCTTTTTTTGGCTTGTCAACAGAAGAGGTATTTGAGTGTCCTGCATGTTTTGTTTACTCACATGTTTTCTTTCTTCCTTTCAGACAAAGCCAAGGTTTCCAACTGTCGAGTCATTGTCCATTGTTTAGCTGGCATCTCCAGGTCGGCCACCATCGCCATTGCTTATATTATGAAGACAATGGGCTTGTCATCAGATGACGCTTATAGG[T/C]AAACTCACTCAGACACCCTGCAGCTTAGATTGCACAGTCTTAGAAAGATATTTTCTGTAGCTGTAATTTTATATCTATTTCCTGCAACATGGAAAATGGATCACATAGAAACTTGCAAACAATACCTGCTGTAGGTTTCCTAAAACGTATCTTTATTCACGGCCTATACATCCTCACATGATGCCTCTTTGTGTTGAATATGTTGTCCTATGCACATGTGTGGATTTTGCCTCAGGGTAATCATTCTTACTCTTCTTGTGTTTCCAGGTTTGTAAAGGACCGCAGACCTTCAATATCACCCAACTTCAATTTCCTGGGACAGCTGCTGGAGTTTGAGAAAGGTCTGAGGTTGCTGAAGGCTCTTTCCTCAGGTCAGGAGAAGTTGGAGCAGTTGAAGGAATTTTCAGAACCTAGAAGCGAATCTTCCAGTGATCCCGAAAAGGGGCGCTTGGAGGCTGAGAAGGATGGCACAGAATTAGATGGCAAGCTGCCTTCTCCAA
Associated Phenotype:
Not determined