Busch Lab

ZMP

vps52

Ensembl ID:
ENSDARG00000009175
ZFIN ID:
ZDB-GENE-010430-2
Description:
Novel protein similar to vertebrate vacuolar protein sorting 52 (Yeast) (VSP52) [Source:UniProtKB/Tr
Human Orthologue:
VPS52
Human Description:
vacuolar protein sorting 52 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:10518]
Mouse Orthologue:
Vps52
Mouse Description:
vacuolar protein sorting 52 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1330304]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa43253 Nonsense Mutation detected in F1 DNA Not yet available
sa4801 Essential Splice Site F2 line generated Not yet available
sa23494 Nonsense Available for shipment Available now
sa18372 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29183
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047190 Nonsense 28 724 1 20

The following transcripts of ENSDARG00000009175 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18319307)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19164542
GRCz11 19 18627395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAAACACATCCGCTGATTCTGTGACCGGTGCGATGGCCTGTATAACGT[T/A]ACACGATGAGGTAATCATCTTTTTTTTTTACATGAAACATCAGCTTTGGC
Long Flanking Sequence:
CGGTACAACTGTACACAGATAAATAAGACCGATGATGCGTGATTTCAACTTAAGCTTTGAGAGTACCATTTCGCACTCACCATCTTGATCGCTGGTTCCGCGCAAAAAGGAAGTTGTCATGGTCTCGCGATATTTTCACCACTTGACACGCAAACTTTAGGGTGGTTCCGCCCTATTTTTTACGGTCTATGGTTCCGTCACCAAGTACATTTCTGATAGCCTGTTATCTAAACTAATATATAAAACCTATGAGGTTTAAAACGTATTATATTACTTATAAGATATTTAATATTGTTTTGTTTTAAATAACATTTCTTAAGATTTTCAAACGTAACACTGCATTTTCGCGGATTTAATAGTTTGGTAACAGGGACTAAAATCCTAAACGGACGTGTAGTTTTTATGTACTACAGACGGCATGGCGGAGGCGCTGATCGGTGGAGCTGTTCATATAAACACATCCGCTGATTCTGTGACCGGTGCGATGGCCTGTATAACGT[T/A]ACACGATGAGGTAATCATCTTTTTTTTTTACATGAAACATCAGCTTTGGCTGTGATCATATTCCACATTTTTGACGTTACACCAGTAAATGCTAACAGCCCCAGAGCTGGATATAATAGAGATGTGTAGTTTGTTATTAAATATCATATAGTTTTAATGTAGTTCGTACAAAGGTTGGTTTAGTAATCGCGATTGCAATGGAGCTATGCAGGTTATTGCTTTATTCAAAATCTGAATATCCCACAAATTTTTGTGTGGCACCATAAGATCACGTGACCAATGTCTGCATTGAAAAAAAACTCACACATGATATTAAGGTACGAATTCAGAAAACACCGATTCTGAGAAGTCATCATGACACAATATGAAAGTATGATTTATCATTTGATGACGTCAATGGTAAAAACATACATATTTTACAAACGAACTTTTTAATGCAAATCATGATTTATAAAAAATAATTAAAAAACGCAGTTGCCCGTTTTTGCAAATGAACATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43253
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047190 Nonsense 288 724 9 20

The following transcripts of ENSDARG00000009175 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18328709)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19173944
GRCz11 19 18636797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGTTCCTGTTAGCCAATGAGAGAACAGTTGCAAAAGAGATCCGGGAC[G/T]AGTATGTGGATACCATGAGCAAAATCTACTTAAGTTACTTCAAGTCATAT
Long Flanking Sequence:
TCCATGACCTACTCAAAATGGATTTGTGACCCATTTTAAGTCACAAAAAACCAATTGAGAAACACTTTAATAGGAATACAAGAATACAAAATTTAGGTTTGTGTTGCAGTTTTTTAATTTTTAATTTTGATCACAGGCTGTCACAAAGATCCGGGAGTTCATCCTACAGAAAATTTACTCTTTTAGAAAGCCAATGACCAACTACCAGATCCCCCAGAACACATTACTCAAGTACAGGTACAAAACACACTCCTTTAAACTAAACCAAACAAAGACTTTGGTTACATCAGAACAAGCAACAGGGGTTATTAGTAAAATTTGTCCTGGTGAATAGCAATTATTAACTCTATTAAATTAAATTCTTAAATAATTAATTTATAGATATTTTATCAATACAATATGTTACACCCCCCTAAATATGTCTGTTTCTGATCATTTATAGGTTTTTCTACCAGTTCCTGTTAGCCAATGAGAGAACAGTTGCAAAAGAGATCCGGGAC[G/T]AGTATGTGGATACCATGAGCAAAATCTACTTAAGTTACTTCAAGTCATATAGTGGCAGACTGCTGAAAGTCCAGGTGAAATTGGTTTAAGATAGCAAAAGGTTTTCAAAATCTAAAAAAATTGTAAATTTGAAGAAAAAAATGTCCATGGAAGTCATTTTGTACAGGTTTAAATCCCAGGACAATATCTGAATGCATAAATTATGTATTCAGAATTGTAACGGAGACACTTACCAAGTAACTAAGACACTTACAAAGTATCAACTCAGATCTTCATAAAATGAATAGAAACATATTTAGCATTAAATAATTAATTCTAATAATTAATAGTCAATTCTCTGCTAAAAACTATTTGCCTTGAAAGTGTCATGAATTTAAACACAAGGAGGCTACTGTGTGTATAAAATATGATATTGTGTAGTCTTATAATGTGCATGTATGATGAAGCTAATGTAATATGCAAGATTATAATATCAAGTGGCTGTACAATTTAAATAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4801
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047190 Essential Splice Site 332 724 10 20

The following transcripts of ENSDARG00000009175 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18330062)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19175297
GRCz11 19 18638150
KASP Assay ID:
554-3570.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGCAGACAAAGATGATCTGATGGGAGTGGAAGATACAGCCAAAAAAGA[T/G]ATCCTTAACTGATTGCTGCCTATTTAGACATAAATGGCAATAGTGACATA
Long Flanking Sequence:
AAACATTCTCTGTCAACTCAAGGTATTTGAATAGAGAATTGACATGGCAAATGATGTAATAAGTTAATATTATTTGCTTCTTGCAAGAGAGAGCTGGTGCAATGAAGTTTAAGATGTATCATTGTTAATAGTAAAATAAATTCAAATAAATTTACAATATAGGAATAAGTTTGACAAGGGAGCTGAATTGAAACATCTGACAATGTAAATTGAAGTATAATAAAGTATTTCTAAACCTCAGCTCGTTAGCTGAAGGGACACTTCTACAGGCACTTACCATCCCACACTCTTAAATCGATGCACTTACATACTCTACATCTTAAAATTAATACAAATATAAAAGTAAAGGCATGCTCAAGGCTCAATGATGTTGTTGTTTTTGTTGTTGTTGTTGTTTTTTCAATTAGTCCTGTTTGTTCCTTCTTTCTCTCTATTCGTCAGTATGAAGATGTTGCAGACAAAGATGATCTGATGGGAGTGGAAGATACAGCCAAAAAAGA[T/G]ATCCTTAACTGATTGCTGCCTATTTAGACATAAATGGCAATAGTGACATACATACACCAAACCTATTGCACCACTGTTTTGGTATCTTTTAACCAATGTCTTATCACAATCACATAGAATTAGCATGCCAAGTAAATTTCAAGTCTTTTTCTATATTCTATTACAACGTGGTTGATTTCTTTAACTGCTCGGCAGGTTTTTTCTCTAAGCCTTCTCTCAAAAGTAGAAACACCATTTTTACTCTCGGCCAAAGGGGGGCAATATTGAGCCCCGCAGAGCTGGAGGGGCCCATACTAATCCCACATGCTGCTCAAAGAGGAGACTCCAGAGTAAGTGATCTATTGCTGTACAAATCTTCCAGTTGCTGCCATGGAAAAGATGCATTTCATACTTTTAATTTCATGCTATTCTTTCTTAGTCAAAGATAGAAACCTGGTAGAAGATAAAACAAGATAAAAACATGCAACAGTTTTTTTTAAAGACCTAGTGGAATTCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047190 Nonsense 379 724 12 20

The following transcripts of ENSDARG00000009175 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18330813)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19176048
GRCz11 19 18638901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACAGTATTTTGTCTCACTCATTTCTCTTTGTCTCTGTCAGTACCCCTA[T/A]GAAACTCTCTTCCGCAGTCAGCACTATGCTTTGCTGGATAATGGCTGTCG
Long Flanking Sequence:
AAGGGGGGCAATATTGAGCCCCGCAGAGCTGGAGGGGCCCATACTAATCCCACATGCTGCTCAAAGAGGAGACTCCAGAGTAAGTGATCTATTGCTGTACAAATCTTCCAGTTGCTGCCATGGAAAAGATGCATTTCATACTTTTAATTTCATGCTATTCTTTCTTAGTCAAAGATAGAAACCTGGTAGAAGATAAAACAAGATAAAAACATGCAACAGTTTTTTTTAAAGACCTAGTGGAATTCACCACAGTATAAATGTTGCCAGCATCAAGATAGTTGAAAGCATATACCCAAATTAATTTGCAATGCAATAGGCTTGACAGCAAATGTAATTCTGTTCCCATCTTTCCAAGCTGTTTTACAATACGTGTACCTAAAAGTAGCATTTTAAAGCCAAAATAGGGTTTATATAAATGTTCATTTAGTAAATGTGTCTGTTTGTGGCTCATAACAGTATTTTGTCTCACTCATTTCTCTTTGTCTCTGTCAGTACCCCTA[T/A]GAAACTCTCTTCCGCAGTCAGCACTATGCTTTGCTGGATAATGGCTGTCGAGAATTCCTGTTCTTGTCTGATTTTTTCATGGTGGCAGGGAATTCAGCACTGGACTTGTTCAACAGCATTATGGGAAAAACACTCAGCATTTTTTTGGTACATTTATTCTCTTACTACAATCTGTGTATTTAAAGGAATGTCACATTACTGAGTATTTGTTTTCTTTTTTTTTCTTTTTTTTAGCATTCTCTAATTTTATTAATAATAGTTTTTTTTCTACCTGTAGAAGAATCTGTCTACATACTTGTCAGACTGTTACGATAGTATTGCAGTATTTCTCTGCATTCACATCATTCTGCGCTTCAGAGCCATCGTAGCCAAGAGGAATATCCCTGCACTTGACAAGTCAGTCCCTGTCAGTACAAACACATTCTTATACCCCTTATTGGTAGTTTTTTTTTTTTTTGATCAAAAATACACCATCAACAATTACTAAAAAAACTTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18372
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047190 Nonsense 396 724 12 20

The following transcripts of ENSDARG00000009175 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18330862)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19176097
GRCz11 19 18638950
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAAACTCTCTTCCGCAGTCAGCACTATGCTTTGCTGGATAATGGCTGT[C/T]GAGAATTCCTGTTCTTGTCTGATWTTTTCATGGTGGCAGGGAATTCAGCA
Long Flanking Sequence:
CCACATGCTGCTCAAAGAGGAGACTCCAGAGTAAGTGATCTATTGCTGTACAAATCTTCCAGTTGCTGCCATGGAAAAGATGCATTTCATACTTTTAATTTCATGCTATTCTTTCTTAGTCAAAGATAGAAACCTGGTAGAAGATAAAACAAGATAAAAACATGCAACAGTTTTTTTTAAAGACCTAGTGGAATTCACCACAGTATAAATGTTGCCAGCATCAAGATAGTTGAAAGCATATACCCAAATTAATTTGCAATGCAATAGGCTTGACAGCAAATGTAATTCTGTTCCCATCTTTCCAAGCTGTTTTACAATACGTGTACCTAAAAGTAGCATTTTAAAGCCAAAATAGGGTTTATATAAATGTTCATTTAGTAAATGTGTCTGTTTGTGGCTCATAACAGTATTTTGTCTCACTCATTTCTCTTTGTCTCTGTCAGTACCCCTATGAAACTCTCTTCCGCAGTCAGCACTATGCTTTGCTGGATAATGGCTGT[C/T]GAGAATTCCTGTTCTTGTCTGATTTTTTCATGGTGGCAGGGAATTCAGCACTGGACTTGTTCAACAGCATTATGGGAAAAACACTCAGCATTTTTTTGGTACATTTATTCTCTTACTACAATCTGTGTATTTAAAGGAATGTCACATTACTGAGTATTTGTTTTCTTTTTTTTTCTTTTTTTTAGCATTCTCTAATTTTATTAATAATAGTTTTTTTTCTACCTGTAGAAGAATCTGTCTACATACTTGTCAGACTGTTACGATAGTATTGCAGTATTTCTCTGCATTCACATCATTCTGCGCTTCAGAGCCATCGTAGCCAAGAGGAATATCCCTGCACTTGACAAGTCAGTCCCTGTCAGTACAAACACATTCTTATACCCCTTATTGGTAGTTTTTTTTTTTTTTGATCAAAAATACACCATCAACAATTACTAAAAAAACTTAAAAGAATTGTTTTGCTCTCGAATGTGCTTCTGGCTTGTTACTTTTCAAATATT
Associated Phenotype:
Not determined