Busch Lab

ZMP

si:ch211-260g14.8

Ensembl ID:
ENSDARG00000009123
ZFIN ID:
ZDB-GENE-041014-221
Description:
hypothetical protein LOC558139 [Source:RefSeq peptide;Acc:NP_001124070]
Human Orthologues:
SELE, SELL, SELP
Human Descriptions:
selectin E [Source:HGNC Symbol;Acc:10718]
selectin L [Source:HGNC Symbol;Acc:10720]
selectin P (granule membrane protein 140kDa, antigen CD62) [Source:HGNC Symbol;Acc:10721]
Mouse Orthologues:
Sele, Sell, Selp
Mouse Descriptions:
selectin, endothelial cell Gene [Source:MGI Symbol;Acc:MGI:98278]
selectin, lymphocyte Gene [Source:MGI Symbol;Acc:MGI:98279]
selectin, platelet Gene [Source:MGI Symbol;Acc:MGI:98280]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5955 Nonsense Mutation detected in F1 DNA Not yet available
sa15565 Nonsense Available for shipment Available now
sa11522 Nonsense Available for shipment Available now
sa39289 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 None None 856 None 15
ENSDART00000111022 None None 835 1 18
ENSDART00000136834 Nonsense 9 648 1 11
Genomic Location (Zv9):
Chromosome 20 (position 34001522)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34074035
GRCz11 20 33976914
KASP Assay ID:
554-3914.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGCCATCAAACAATAAAAGGGGGCAAAAAGTACAGAACTACAAACTAC[A/T]GAAAGGACCATAAACAGGACCACTGCAGAACATCACTGATAATGGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 Nonsense 78 856 3 15
ENSDART00000111022 Nonsense 41 835 3 18
ENSDART00000136834 Nonsense 100 648 3 11
Genomic Location (Zv9):
Chromosome 20 (position 34000791)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34073304
GRCz11 20 33976183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGATTGYTCACCTCAACGGAATTCTTCCAAGACGCAATGGCTRTTACTG[G/A]ATTGGTATTCGTWAAATTAATAACCAGTGGACCTGGGTGGGAACTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11522
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 Nonsense 83 856 3 15
ENSDART00000111022 Nonsense 46 835 3 18
ENSDART00000136834 Nonsense 105 648 3 11
Genomic Location (Zv9):
Chromosome 20 (position 34000778)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34073291
GRCz11 20 33976170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACGGAATTCTTCCAAGACGCAATGGCTATTACTGGATTGGTATTCGT[A/T]AAATTAATAACCAGTGGACCTGGGTGGGAACTAACAAAACACTTACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39289
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 Essential Splice Site 805 856 None 15
ENSDART00000111022 Essential Splice Site 768 835 None 18
ENSDART00000136834 None None 648 None 11
Genomic Location (Zv9):
Chromosome 20 (position 33996483)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34068996
GRCz11 20 33971875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATAGAGTGAGACCGACATTCTACAGCTTTCTCTTTAACTATATTTAC[A/T]GCTCAACCTGGTCCCTCTAAATCGCTCTTCAAAGCAACAGAAGTGGCTCT
Associated Phenotype:
Not determined