Busch Lab

ZMP

gata2b

Ensembl ID:
ENSDARG00000009094
ZFIN ID:
ZDB-GENE-040718-440
Description:
GATA-binding protein 2b [Source:RefSeq peptide;Acc:NP_001002689]
Human Orthologue:
GATA2
Human Description:
GATA binding protein 2 [Source:HGNC Symbol;Acc:4171]
Mouse Orthologue:
Gata2
Mouse Description:
GATA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:95662]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14633 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14633
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022731 Nonsense 88 427 3 6
ENSDART00000144479 Nonsense 89 428 3 6
Genomic Location (Zv9):
Chromosome 6 (position 40726636)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40798236
GRCz11 6 40795772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTAAGACTATAACNTTTTTTCNTTTTTGCCAGCACGCCTTACGGGTGGYT[C/A]AATGTRTCGACCTCACCTTATCAACACTCACGGTCTTCCTTTACTGGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26798
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022731 Nonsense 312 427 5 6
ENSDART00000144479 Nonsense 313 428 5 6
Genomic Location (Zv9):
Chromosome 6 (position 40730349)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40801949
GRCz11 6 40799485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGTTTTGATCTTTGTCTTAATGTGTTTGTATGTTGCAGTCAGCATCT[C/T]GACGAGCAGGCACCTGTTGTGCCAACTGCCAGACTGGGACCACCACACTC
Associated Phenotype:
Not determined