Busch Lab

ZMP

LOC100329924

Ensembl ID:
ENSDARG00000009017
Human Orthologue:
SCYL1
Human Description:
SCY1-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:14372]
Mouse Orthologue:
Scyl1
Mouse Description:
SCY1-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1931787]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44375 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44375
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007671 Essential Splice Site 281 855 7 18
Genomic Location (Zv9):
Chromosome Zv9_scaffold3489 (position 24686)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46601972
GRCz11 14 45589264
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTATTTTATATTTGGCTATATGAGTCACTTGTTTGTTTGTGTGTTGT[A/C]GATTAAAGAGCCTGCAGAGAAGCAGCAGTTTTTCCAGGACCTGAGTGAGA
Associated Phenotype:
Not determined