Busch Lab

ZMP

col11a1b

Ensembl ID:
ENSDARG00000009014
ZFIN ID:
ZDB-GENE-070912-607
Description:
collagen alpha-1(XI) chain [Source:RefSeq peptide;Acc:NP_001171883]
Human Orthologue:
COL11A1
Human Description:
collagen, type XI, alpha 1 [Source:HGNC Symbol;Acc:2186]
Mouse Orthologue:
Col11a1
Mouse Description:
collagen, type XI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88446]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa19707 Nonsense Available for shipment Available now
sa18075 Nonsense Available for shipment Available now
sa18515 Nonsense Available for shipment Available now
sa19706 Essential Splice Site Available for shipment Available now
sa11917 Essential Splice Site Available for shipment Available now
sa18432 Nonsense Available for shipment Available now
sa9895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 13 1815 1 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location (Zv9):
Chromosome 2 (position 15383190)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15894017
GRCz11 2 15562607
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGGCTCCGGTCATGGATAAGGATAAGGAAAGGTGGTCCACGAGATGG[A/T]AAACGAAAAAGTGTCTCAGGAACTCCGTTTTAAGTGCAATCTTCAGTCTG
Long Flanking Sequence:
CTAGGCAAGTCTCTGTGACTGTGACTCTCTCCTCCTGTAAACCGGTGTCCCTTCCCCATCATCCCGGTGTCGTATCCCTCAGAGCAGATACACCTTTGCTCTGAGGTTTCGGGGGAACGGTGTCAAACTTTTGAAGCACTCGTCAAAATAATGGGCGGATCTTTCCAAGACGGCCGTTTTTCCCTTGTTCATTTCTTTTTCCTCACGGGTCAGGTTTAGTCCACACGTCCAACCCTCCAAAAAGACTTGGGCTCTTCAGGGAACAAACGGGTTTCCCTTTTTTTCACAAGAGCCCGTTTACCTTCAGTCTGAGCGTCTGCTGGGCGGAGGGACTGTGGAGTTTCTTCACGACGTAAAACCAATTGATATTTTCGCTCATGGCAATGCAGAAATAATTGACAATAATCTGGATTGAGTAAAAAGGAACGATTTTGAAATTAAGACGCAGTTGAGGGGCTCCGGTCATGGATAAGGATAAGGAAAGGTGGTCCACGAGATGG[A/T]AAACGAAAAAGTGTCTCAGGAACTCCGTTTTAAGTGCAATCTTCAGTCTGACTTTTGTCCTACAGGCAACACAAGTGAGAGCAGGTAAGGCTGAGGAGCATCGTTCACGAGTGATGGTGCTAGCCTTCAGTATAGCTTGTTTAATTCTTTAAGGTAGGCAATTTCTAATGAGTATGTTCCTGCGTCAAAATATAATTAAAACTTTGTTTATAACGTGGAAATATTATTGGCTGTGGCTCAAAAACTACCGAGCTGCCTACCTAGACAGCTGATCGTATCACAGGCGCGGTCAGAACTAAAATGCATTTTTTTAGAGTTCAGTCTCTATGAGAAGTGTTTAAAATAATATTTTAAGCATCATCTTGCCTGAAATTGCTGCCTCGTGGTATTAAATGATTTGATGAGAAAATGTAATGTGTCTTTGTATTTGATGTCTTTACAGCACTGGCTGTTTATTTATATTATTATACTTATATATTTAATTTAATGCATGATACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18075
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 237 1815 5 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 Nonsense 197 265 4 6
ENSDART00000142536 None None 892 None 33
Genomic Location (Zv9):
Chromosome 2 (position 15338756)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15849583
GRCz11 2 15518173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGGGGACATCCAGCARCTTCTTCTGGTGGCGGATCCTCGTGCAGCCTA[C/A]KACTACTGTGAACACTACAGCCCTGACTGTGAAACCCCTCAYCAGGACAC
Long Flanking Sequence:
ATGCGCCCCTATTTTAAAAATGTATTTAGTTTATTTTAATGTGAGTTTATCTCTCTGTCTGGGTATATCTTTATTTATCTGTCTACATCTTTATCTATTTGTCTATGTCTGTCTGCCTCAGTCTATATATCTGTCTGTGTGGTTATATATATCTTTCTTTCTGTCTGTCTGTCTGTCTGCCCACCTGTCTGTCTGTCTGTCTGTCTGAATATACCTTTCCCTATCTGTGTGCCTATATCTCTGTCTGTCTGTCTGTCTGAATATACCTTTCTCTGTCTTCTACCTATATCTCTGTCTGCCTGTCAGTCTATATCTCTGTGGGTTTGTCTAGTTAGTAAAAGAGATAAACACATTCAATATCCCTTTGGTAAACTAGAAATGACACAAATCTTACAGTACGTATGTCCAAATATCCAGAATGATTCTGATAAATGTTTCTATGATGTCATTCAGGGGGACATCCAGCAACTTCTTCTGGTGGCGGATCCTCGTGCAGCCTA[C/A]GACTACTGTGAACACTACAGCCCTGACTGTGAAACCCCTCACCAGGACACTCCACAGGCCCAGGAACCCGAGGAAGAGGTCAGTGTGTGTGTCTGGAGCTCCCCCAGACCAGTGTGTGCGATGATGTATTGATGGATTATATATGGTCTACACCCACAGCTTCTGTCGGGGGGCTTTCTTAGGCCTGGTTTCAAAAACACTGCCAGATTTCTGAATTATTATTCACAGGGGATGTGCACTAGTTTGGTCAACTAGTGAAAACATTGTTTGAACTCATCAGATTGAGTTTCATTCTTTGGTGCATTTCCCTCTTTTTTTAAATGTCTTTATGCAGCTGTGAAGAAAGAGAGAGCCCAGCTGAATTTTTTCAGTTTATTGTTTTATTTTTTAAGTAAAAACTTTTTTGTTTTATTATCCAAACTACTGATAACATTGTAAGGCATTTAGAGCTTTTTTTCATACATTTTTTTTTTTTTAGATGTTTATGTGGTTAGTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 399 1815 8 67
ENSDART00000133069 Nonsense 69 312 1 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location (Zv9):
Chromosome 2 (position 15327485)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15838312
GRCz11 2 15506902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGATAGACCCCAGCAATTATGATGATTCCTTCTATGACTACACTAAT[G/T]GAGTAAAACCCACCGGATCAACCTATGAGGACGAGATTGGACCTGGACGA
Long Flanking Sequence:
ACGTATGTATGCAAGTGTATATATTGTATGTATGTATGTATATATATATATATTATTTGGAAAGCTATCCGTTAAACAGCAATTGAACAGATATTAGGCCAGTTGACACATTTGAATATAAAAATGGTCTCATTTTAAATTATTCAGCGCATTTTTTTTTATTTAATTTCACTAGTGGAGCTTCATCAAAAAAGTATTAATTTAATGCTTGGGTCTACACATGGACTAACCTCCCTGTTCTCTTAATGCTCTCATCTACTGTCTGCCCTGCTGATCAGAATCCATCACCGAAAGAGGAAATAGTAGACGACTACATTACAGGCGTAGAACAAGTTGGCGTGGATGCCACCGCCGCCACCGAGGAGAGTGTGAAATATGTGGAGTCCAAAAGCACAAATGGAGGCGAAACCGAGGACTTTAAGGAATACGACCTTAACACATATGATGCAAAAGAGATAGACCCCAGCAATTATGATGATTCCTTCTATGACTACACTAAT[G/T]GAGTAAAACCCACCGGATCAACCTATGAGGACGAGATTGGACCTGGACGACCTGCGGAAACTGAGGTCACTGAGAGCAATGTGAGTTCACTTCTCTATATATCTCTATGGCCTTGTGTACATCTGTATTAGGATGCATTTTGGTCTATTGCATAACAAGTAGACAGGAGAGACACATTCCTGTTCACACCTGCTGTGTAAATCTGTGTTTTGTTGACTTTTGACAAGTTTTCTGATAAAGGGTATATGGGTAATGTGAAATATAGTATATTGAAAAGTATAATGGGTAATTGTTCAAGCAGTGAAATCAATTACTTATACAATATGCTTCATAAATTGAATAATATAATTACAAGTACACTGTTATATGTTATTTATTTATTACCTTTCAGGTCAGTTGCTAATTAAGCATTTATATAGTTTTAAGATGCATAGACATTTTTGTCACGCTACTTAAAAAAACAACAACGACAAGGATCCAAGATGCATGGTCTTAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19706
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 690 1815 22 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location (Zv9):
Chromosome 2 (position 15296575)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15807402
GRCz11 2 15475992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGGACTGACTGGTTTGGATGGACCACCTGGCCCTAAAGGAAACATG[G/T]TAAGTATTTGATCTCCTCCTGTTCAATAGTGTGAGTGTCACTAAAGTGAG
Long Flanking Sequence:
TATTTTTATATTAATTTATAATTTTCTTATATACTTTAAATTATATTATTTTATTTTATTATTTAATTAATTAATATTTAATTAATTTATTTTTTGTTTAATTTGGTATTTGTCCAATTTTAGGTACCTGTTATCAATTTATATGATGTGATTTTCTTGTCTATATATATTTATTATTCAAAATATAATGCTTTGCAGTTTTAGGGGGTCCATACTGTACATGTATTGTTTGGCCTGGAAAAGGTTGAAGACCACTTTTACTCACTATAATGTTCTACTGAATCCTCCTAACATGTGGTTTTTGATGATCATCAGGGTCCAAGAGGTCTGCTGGGCCCCAGAGGATCTCCTGGTACTGCTGGACAGCGTGTATGTACTACCAGACTTTTTCTTAGTCACAAATATTCTAATATCATGAAACTGACAGCCAGACACTTGTGTTTTCACACATGCAGGGACTGACTGGTTTGGATGGACCACCTGGCCCTAAAGGAAACATG[G/T]TAAGTATTTGATCTCCTCCTGTTCAATAGTGTGAGTGTCACTAAAGTGAGCCATTTCTGAGTTTTAGGACTCTGGTTAACTGTCCCATGCTGACAAACTTTAACCTCTCTGAAACATATGTGTTGTCCTGAGCAAAGGTCAGCCTAAAGAAGGCTGTCAGAGAGACCTAATGGCAGTGTCAGGACAGAGCTAATGGCAGTGTCACTGGAGCAGCAGGAGGCTGATCTTTGACCTGGAAGTGCTGAAATGAAGAAAGCATGAAGTCTGACACTAAAATATGCAGCGCAAGAAGTGAAAGATTCATCTGGGGATTCAGTGTTTTCAGCTTGACTATTTTCCCACACACATTTGTTAAACAACTGAGGTCCATGGATGGATGGACGGACGGGCGGACGAATGGATGGTTACAAATATTGGACAGATGGATGGATGGATGGTTGGATGGATGTATGGAAAGAGATGGACAGATAGATTGATGATGGAAGGATAAAGGATGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 913 1815 35 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location (Zv9):
Chromosome 2 (position 15272558)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15783385
GRCz11 2 15451975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAGTCAAAGCTTTCTSGTAACAAGCACCTGTGACTGTGTTTCTGTTTA[G/T]GGAAYATCAGGAAATGATGGACCAWCTGGTGGCCCAGGAGAGAGAGTAAG
Long Flanking Sequence:
AAAAAGGCCAAAATAAATAAAATTAAAAAAGTGTATTTTATAATTATTTTTTAAAATATGATTTGCCTTCTGCACCTCATCTTTAATTGAAAACTGACAACATGGACTATATTTAATAAAAAACAAAAATATTTATGAAATATCTTGCCAAATAATTACACTTACCAAGTCAGAGGCCTAAACGACAGGTGCTCAAGCATCACTATAGTCCTGTCAGCACTTTTGACAGCCTTTCCAAATTTCTGAAGCCACCCAATTTGCTGTAAACGGCTGCCTCATAATTCTCTACGCAGGAAAAACCCTGATTTGTCCAAATTGGCTTGTAATACTCAAGCGTATGGCTAATAACTCTTGCTTTCAGGGTCCCCGCGGTGGAAGAGGTGCCAGAGGTCCAACAGGAAAACCCGGAGCTAAGGTCAGGCTTCATCTGTGCTCATTTTCACTAACTCAATTAGTCAAAGCTTTCTCGTAACAAGCACCTGTGACTGTGTTTCTGTTTA[G/T]GGAACATCAGGAAATGATGGACCATCTGGTGGCCCAGGAGAGAGAGTAAGTGATGGTTGAGTTATTTTTTCTGATCGAGTGTTTTTATAAGGCTTTTTCAGGTCAGGCAATTATTTTTCTATTACGTCGTCTTGTAGTAATTTGTATTTCTTCATGTTTTAGGGACCCCAAGGACCTCAAGGACCTGTTGGATTGACTGGCCCAAAAGGCCCACCTGTATGTGGTTACATTAGTTTCATCTACTTATTATTCTGAGATGTTATACTTGTTGATTCACAGTGTGAAAGCCCATTTCTGTTACATAAGACAAAAAAGAGGCATGTTTAGGTAAATCCTAATTATGACACTGTCACATAAGGGTCTACAACAACAGAGGTGAGGATCCACATGCAGTTTATTAGGAATAGTTGTCAGGCAGGTAACAGTCAAACAGGTAGCAAACAGGAGCATAAAGGTTATCCAAGATCGTAGTCAAAAACAAGTGAAAGGTCAGTACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 1054 1815 41 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 Nonsense 131 892 7 33
Genomic Location (Zv9):
Chromosome 2 (position 15264890)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15775717
GRCz11 2 15444307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATTATTCTCTTTCTGTCNNTTTTTTTGCAGGGYCTGTCAGGTCTGAWG[G/T]GAGGCRAKGGTCCRCAGGRTCCACAARGCCCTAGCGTAAGTACCTACTTT
Long Flanking Sequence:
TAGGCTACTCAAAGGACATGTAAGTGAAAAGGGCGTCTCTACTCATTTTTCTACATTAACAAGATTTAGGCTGTGGGACCGAATATAATCAATTACTGTTTTGTTTTTAGTTTCTATTGTGAGTTGATGCTGAAAGTCACATTTAAAACACGAGCCAATAAGATCTCAATAAACAACTGTTGATTTTACAGTCACTCATTGTTTTATGTTGACTTTCAGTTGGCTCATATGTTTTTTTATGACTCAAATTATGACTTGATGGGGAGGAAAATGACGCATTATTGGTGTCACATGACACCTGCGCTGCCAGCATTTGGATTCTGATGTAGTAAATTGGGAAAGTGCCAGTTTGCTAAACACTCTGGGCTGTATTTCCAGTAGGCATAGAGTACAAACAGCTGGCACAACTACATGCAGATGCCACTTTGACAGCAGCTCTCATTACAGCTCTCATTATTCTCTTTCTGTCACTTTTTTTGCAGGGTCTGTCAGGTCTGAAG[G/T]GAGGCGAGGGTCCACAGGGTCCACAAGGCCCTAGCGTAAGTACCTACTTTACCATTGAAACTCTCAAAAGTCAGTGTGCAAGCTTTGCTACTGTTAGTAAAGTGACACCAGGCGAATCCTGGAGTGGCAGTAGTCAGCAGGTGGTGGATTTAATGACCAGTAATGTTGGCACTGAGAGTGCAGTTTGGTGTGTGTGTGTGTGTGTGTGTGTGATCTGAGCCCACGCAGTCTGATCACGCTCAATGAGTCAGGCTTAATCAATCTGTCCGTCATAGATAGAAACTGATTATGACTCATACATGAAATATGCTCAGAGAGTCAGAAGTCATGTCAAGATTATTAGAGATACTGTATGTCTGTATCTGCTCAATGAAGCATGCTTACATTATGATGATAATTTACATGTGATAGTAAATGCAGATCAGGTAAAACTGAGAATTTTACAACTGAAAGGTAACATTGAAAAAGAAAGTGAAACTAATGGCATCTATATTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9895
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 1282 1815 51 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 Essential Splice Site 359 892 17 33
Genomic Location (Zv9):
Chromosome 2 (position 15235752)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15746579
GRCz11 2 15415169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAYCRTGGATGGGTGAGWRCTGGATGTTGATACTTCTAATGTTGCTTCTT[A/G]GGGACCCAAAGGTGAGCTTGGAGAGAAAGGAGAAGCTGGTCCTCCGGGAG
Long Flanking Sequence:
TCCAACATTTTTTTTCAGAGATTGTGCTCTTCAAATGTTATTAAAAACTGACTTTAAATGGTCAGTTTAATTCACCTTTATTTGTGTAGCGCTTTTACAATGTAGATTGTGTCAAAGCAGCTTCACATAGAAGATCCTAGTAAATTGAAACAGTGTCAGTTCAGTTTTTAGAGTTTAAGTTCTGTTCAGTTTAGCTCAGTTCAGTTTAGTTTAATAGTCACTACTTAGAGTCCAAACACTGAAGAGCAATCCATCAATGCGCAGCTCTACAGATTTCGAACCATGCAAGCCAGTAGCGACAGCGGCGAGGAAAAAACTTCACCAATTTGCGAACGTGAAGAATTAAAAAACCCTGAGAGAAACCAGGACCAAATTTTCTAACGAAACAATTTCATACCAACTTTAATGTCTCATTTAGCCATAAAAAGCATATCTTTCATTTATGGTATTCACCATGGATGGGTGAGAGCTGGATGTTGATACTTCTAATGTTGCTTCTT[A/G]GGGACCCAAAGGTGAGCTTGGAGAGAAAGGAGAAGCTGGTCCTCCGGGAGCTGCAGGACCTGCCGGTGGAAGAGGACCTCCTGGAGATGACGGTCCCAAAGGAAACCCAGTAAGTCATCGTCTACTGAACATCTCATTCATCTGAAATTCAATTCAATTCAATACATGTTTATTTATATAGCGCTTTTACAATGTACATTGTTTCAAAGCAGCTTAACAAAGAGTTTTTGGTAAATGTAAATGATAAACTGAAATACTGTTTTATGACTGAACTGATCAGTAAGTTTTTTTTTTTTTTTTAATTTAGGGTCCTATCGGCTTCCCTGGAGATCCAGGTCCCCCTGGTGAGCCCGGAGTTGGTGTACGTTCAATATGGACATTCAAGCACATGCTATTATCATAAAAGGCTTTAATGACTAATCAAAAGTCAAAATGTCAACAAAAAAAGCAGATTTAGTTATTCATGAATTGGGGTTTTACATTGTACACAAATAACCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25782
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 1443 1815 57 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 Essential Splice Site 520 892 23 33
Genomic Location (Zv9):
Chromosome 2 (position 15225121)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15735948
GRCz11 2 15404538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGGACTTCCTGGAGCTGCAGGCCAAGATGGACCTCCTGGACCATTGG[T/A]AAAATCAGTCTTCGTTATAAATAACACCTTTATAATTTTACCAAAACACT
Long Flanking Sequence:
TAAAAAATAATAAGAAATGTTCAAACTACAGTCAAAATAAAAATCTACTATAGTTACTCATTGATACTACAATATCATTGTATGTATGTCAAACTCAATCTCTATTTCTATCTTCACAGGGTGAAGCCGGTGCTGAGGGACCAGGGGGCAAAACTGGGCCTGTGGGCCCCCAGGGGCCTCCTGGAAAGTCTGGTGCTGAAGGCTTACGTGGCATTCCTGGGCCTGTGGTATGCATTTAAAACTCTGATAAAAGCCAAACTGTCTGCATAATTGTATTATGTGAACAGAACAGTCCACAAGAATCTCTTAATTTGAATGATTAAGCTTTTCAAGTTGAATCACTCTCCATGTCTAGCCGGTGGGTTTGAGTATGTGTGACATGCATTAATTTTTTGCATATTTGGGTTTTTATTAATGGGCTAATGGTTTCTGTCTGCACTCTCAGGGTGAACAGGGACTTCCTGGAGCTGCAGGCCAAGATGGACCTCCTGGACCATTGG[T/A]AAAATCAGTCTTCGTTATAAATAACACCTTTATAATTTTACCAAAACACTTAACTTTGACATGTATGTGATTAATTCTAGGGTCCTCCAGGTCTTCCTGGCTTGAAAGGTGACCCTGGTTCTAAGGGTGAAAAGGTATGTTTTAACAAATAATTCCCTTTTTTAATATGCAAATAACAAGGTGCAACAATTTTTAATGTTAAAAACGTATTAATACATAATTGTTTTATGAGAAAAGGGTTTCTCAAAGTCTCAATTCAAATGTTAATATCTGAATTTTTTTATTGGCTACTGTATGTTTCCATCCCAATGCTCCATTATAATGCTGATGTCTTAAAATTGCATGACTTTTCTTATGCTTACACTGGAATTTATTTTGGTAAATGAGTCTCCGTCGTAGTTTATGCACATATTTTTAGGGAATATTCCAAAATTCACAATAAAATAGGTGGATGGAAACATAGTTAAAGTCAAAGTTCTAAAAAATATTGTTATTGCAAA
Associated Phenotype:
Not determined