Busch Lab

ZMP

e2f7

Ensembl ID:
ENSDARG00000008986
ZFIN ID:
ZDB-GENE-030131-3527
Description:
transcription factor E2F7 [Source:RefSeq peptide;Acc:NP_001038612]
Human Orthologue:
E2F7
Human Description:
E2F transcription factor 7 [Source:HGNC Symbol;Acc:23820]
Mouse Orthologue:
E2f7
Mouse Description:
E2F transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:1289147]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33361 Nonsense Available for shipment Available now
sa20179 Essential Splice Site Available for shipment Available now
sa40203 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33361
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Nonsense 104 723 2 12
ENSDART00000140760 Nonsense 104 723 3 13
Genomic Location (Zv9):
Chromosome 4 (position 2415113)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2613992
GRCz11 4 2544103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCGAATCTGAAAATGCTGATCAATGCTGCTAGTCCAGATATACGTGAC[A/T]GAGAAATGAAGAAAACCCTCTTCAAACCCATTGAAAATAAAGGGAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20179
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Essential Splice Site 184 723 3 12
ENSDART00000140760 Essential Splice Site 184 723 4 13
Genomic Location (Zv9):
Chromosome 4 (position 2413867)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2612746
GRCz11 4 2542857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTCTGAAAGCATCAATATTTCCCTGGATGAAGTGGCCACATGCTTGG[G/T]TAAGAGAAAATGACTGCCAAACACAATCTGTTTATGGGTTGACCTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40203
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Nonsense 425 723 8 12
ENSDART00000140760 Nonsense 425 723 9 13
Genomic Location (Zv9):
Chromosome 4 (position 2407675)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2606554
GRCz11 4 2536665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGAGCCGGTGGATTACTCCAGGAAAAGCGGGAACAACAGTGCAGTGTG[T/A]CGACTGCAGTTTGGAGACGGGTGAAGATTTGTTTGCTTGTTTACTTAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26197
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Nonsense 661 723 11 12
ENSDART00000140760 Nonsense 661 723 12 13
Genomic Location (Zv9):
Chromosome 4 (position 2403522)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2602401
GRCz11 4 2532512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACTGCAGAGCCCAGAACATCATGGGAACGTACCAGCCACAACATCAT[C/A]ACCACGAGCAGAAGAGAGCCCGAAACCAGCACAAACACAGGTACTGCATA
Associated Phenotype:
Not determined