Busch Lab

ZMP

tbl1xr1

Ensembl ID:
ENSDARG00000008966
ZFIN ID:
ZDB-GENE-040426-1192
Description:
transducin (beta)-like 1 X-linked receptor 1 [Source:RefSeq peptide;Acc:NP_956903]
Human Orthologue:
TBL1XR1
Human Description:
transducin (beta)-like 1 X-linked receptor 1 [Source:HGNC Symbol;Acc:29529]
Mouse Orthologue:
Tbl1xr1
Mouse Description:
transducin (beta)-like 1X-linked receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2441730]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12656 Nonsense Available for shipment Available now
sa7261 Nonsense Mutation detected in F1 DNA Not yet available
sa1795 Missense F2 line generated Not yet available
sa32840 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 298 362 10 14
ENSDART00000085132 Nonsense 298 511 8 14
ENSDART00000146360 Nonsense 298 510 10 16
Genomic Location (Zv9):
Chromosome 2 (position 7561035)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978689
GRCz11 2 7776694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAACTTTCAGACCACYATTATTTGGGACGCACACACAGGAGAGGCCAAA[C/T]AACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGAYGT
Long Flanking Sequence:
CAGGACTTTTAGAAATAAGTTTTCTGAGAAAAATAATGACGTGTTAAATACTTTTCCCCCCATTGTACATCATATAACTCAGGATATTCTTGACAAAGCTACAATGCGTACCCAATCTGCCATGATACAATGGTAAATAAAACTGTTGTCATGCCAACTTTCTAGTTTGCAATTGTTGCCCCACCTCCAATATCGTCTGATTGGCCCTCTGCTTTTGGAGCTAACAGTGATGAGCTGCGCTGCTTGTGTAAAGTTGAAGATGTTGACATGGCATGCAATAACATGTAATGCTAAAACACGTCCGTCAACTGCTTGTTTACATTGGAATACAATAGAAAAGTAGCGTGTTGGAAAGGATAAATGCATTCTGTGTAAACGGCCCCTTAGTCTGTAGCCCTGTTGTACTCCATCAAGTAGTATGTGGTGAAACTGAAATGTTAATGAGTTTGCGTAACTTTCAGACCACCATTATTTGGGACGCACACACAGGAGAGGCCAAA[C/T]AACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGACGTTTTTGTCTAAATTTTGACATTTAGTCAATTTTACTAATTCAGATTTTTTTTTATCCAAATGTGCCAATTGTATGTGAACTTGCTTGAAAAGAATAGTCAAGAATGGCTCATTTTTGTCTTCTCAGCTCCAGCTCTGGACGTGGACTGGCAGAGCAACAACACATTTGCATCCTGCAGCACAGACATGTGTATTCACGTGTGTAAATTGGGCCAGGAAAGACCAATCAAAACATTCCAGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGAAATAGTGCATATATTCTGACTTCATTTACGTGGTATAACTGTTACATGGTCAATAACTGTTGTGAACAGGCCTTAAGTGATCACTCTTTAAACTCTTTCCTCAGAATGAAGTCAATGCAATCAAATGGGATCCGACAGGGAATCTCTTGGCCTCCTGCTCTGATGACATGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7261
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
Genomic Location (Zv9):
Chromosome 2 (position 7560795)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978449
GRCz11 2 7776454
KASP Assay ID:
554-4387.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGACTGGCAGAGCAACAAYACATTTGCRTCCTGCAGCAYAGACAWGTG[T/A]ATTCACGTKTGTAAATTGGGCCAGGAAAGACCAAWCAAAACATTCCWGGG
Long Flanking Sequence:
TGCTTGTGTAAAGTTGAAGATGTTGACATGGCATGCAATAACATGTAATGCTAAAACACGTCCGTCAACTGCTTGTTTACATTGGAATACAATAGAAAAGTAGCGTGTTGGAAAGGATAAATGCATTCTGTGTAAACGGCCCCTTAGTCTGTAGCCCTGTTGTACTCCATCAAGTAGTATGTGGTGAAACTGAAATGTTAATGAGTTTGCGTAACTTTCAGACCACCATTATTTGGGACGCACACACAGGAGAGGCCAAACAACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGACGTTTTTGTCTAAATTTTGACATTTAGTCAATTTTACTAATTCAGATTTTTTTTTATCCAAATGTGCCAATTGTATGTGAACTTGCTTGAAAAGAATAGTCAAGAATGGCTCATTTTTGTCTTCTCAGCTCCAGCTCTGGACGTGGACTGGCAGAGCAACAACACATTTGCATCCTGCAGCACAGACATGTG[T/A]ATTCACGTGTGTAAATTGGGCCAGGAAAGACCAATCAAAACATTCCAGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGAAATAGTGCATATATTCTGACTTCATTTACGTGGTATAACTGTTACATGGTCAATAACTGTTGTGAACAGGCCTTAAGTGATCACTCTTTAAACTCTTTCCTCAGAATGAAGTCAATGCAATCAAATGGGATCCGACAGGGAATCTCTTGGCCTCCTGCTCTGATGACATGACGCTAAAGGTGATCTGCAAACAACCTTGATTTGATTTCTCACTACCTTGATGGAAAACTCTTCACTTACATATCTGAATTAATAGTTTATTAATAATGTGGACTTGTGTGTATTGAATGTCAGCTTTGGAGTATGAAGCAGGACACTTGCGTTCATGACCTGCAAGCCCATAGTAAGGAGATCTACACCATAAAATGGAGCCCAACTGGACCTGGAACCAACAACCCCAATGCCAACCTCATGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8363
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
Genomic Location (Zv9):
Chromosome 2 (position 7560795)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978449
GRCz11 2 7776454
KASP Assay ID:
554-4387.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGACTGGCAGAGCAACAAYACATTTGCRTCCTGCAGCAYAGACAWGTG[T/A]ATTCACGTKTGTAAATTGGGCCAGGAAAGACCAAWCAAAACATTCCWGGG
Long Flanking Sequence:
TGCTTGTGTAAAGTTGAAGATGTTGACATGGCATGCAATAACATGTAATGCTAAAACACGTCCGTCAACTGCTTGTTTACATTGGAATACAATAGAAAAGTAGCGTGTTGGAAAGGATAAATGCATTCTGTGTAAACGGCCCCTTAGTCTGTAGCCCTGTTGTACTCCATCAAGTAGTATGTGGTGAAACTGAAATGTTAATGAGTTTGCGTAACTTTCAGACCACCATTATTTGGGACGCACACACAGGAGAGGCCAAACAACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGACGTTTTTGTCTAAATTTTGACATTTAGTCAATTTTACTAATTCAGATTTTTTTTTATCCAAATGTGCCAATTGTATGTGAACTTGCTTGAAAAGAATAGTCAAGAATGGCTCATTTTTGTCTTCTCAGCTCCAGCTCTGGACGTGGACTGGCAGAGCAACAACACATTTGCATCCTGCAGCACAGACATGTG[T/A]ATTCACGTGTGTAAATTGGGCCAGGAAAGACCAATCAAAACATTCCAGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGAAATAGTGCATATATTCTGACTTCATTTACGTGGTATAACTGTTACATGGTCAATAACTGTTGTGAACAGGCCTTAAGTGATCACTCTTTAAACTCTTTCCTCAGAATGAAGTCAATGCAATCAAATGGGATCCGACAGGGAATCTCTTGGCCTCCTGCTCTGATGACATGACGCTAAAGGTGATCTGCAAACAACCTTGATTTGATTTCTCACTACCTTGATGGAAAACTCTTCACTTACATATCTGAATTAATAGTTTATTAATAATGTGGACTTGTGTGTATTGAATGTCAGCTTTGGAGTATGAAGCAGGACACTTGCGTTCATGACCTGCAAGCCCATAGTAAGGAGATCTACACCATAAAATGGAGCCCAACTGGACCTGGAACCAACAACCCCAATGCCAACCTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1795
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 None None 362 None 14
ENSDART00000085132 Missense 338 511 9 14
ENSDART00000146360 Missense 338 510 11 16
Genomic Location (Zv9):
Chromosome 2 (position 7560760)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978414
GRCz11 2 7776419
KASP Assay ID:
554-1787.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCACAGACATGTGTATTCACGTGTGTAAATTGGGCCAGGAAAGACCAA[T/A]CAAAACATTCCWGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGA
Long Flanking Sequence:
CAATAACATGTAATGCTAAAACACGTCCGTCAACTGCTTGTTTACATTGGAATACAATAGAAAAGTAGCGTGTTGGAAAGGATAAATGCATTCTGTGTAAACGGCCCCTTAGTCTGTAGCCCTGTTGTACTCCATCAAGTAGTATGTGGTGAAACTGAAATGTTAATGAGTTTGCGTAACTTTCAGACCACCATTATTTGGGACGCACACACAGGAGAGGCCAAACAACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGACGTTTTTGTCTAAATTTTGACATTTAGTCAATTTTACTAATTCAGATTTTTTTTTATCCAAATGTGCCAATTGTATGTGAACTTGCTTGAAAAGAATAGTCAAGAATGGCTCATTTTTGTCTTCTCAGCTCCAGCTCTGGACGTGGACTGGCAGAGCAACAACACATTTGCATCCTGCAGCACAGACATGTGTATTCACGTGTGTAAATTGGGCCAGGAAAGACCAA[T/A]CAAAACATTCCAGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGAAATAGTGCATATATTCTGACTTCATTTACGTGGTATAACTGTTACATGGTCAATAACTGTTGTGAACAGGCCTTAAGTGATCACTCTTTAAACTCTTTCCTCAGAATGAAGTCAATGCAATCAAATGGGATCCGACAGGGAATCTCTTGGCCTCCTGCTCTGATGACATGACGCTAAAGGTGATCTGCAAACAACCTTGATTTGATTTCTCACTACCTTGATGGAAAACTCTTCACTTACATATCTGAATTAATAGTTTATTAATAATGTGGACTTGTGTGTATTGAATGTCAGCTTTGGAGTATGAAGCAGGACACTTGCGTTCATGACCTGCAAGCCCATAGTAAGGAGATCTACACCATAAAATGGAGCCCAACTGGACCTGGAACCAACAACCCCAATGCCAACCTCATGCTGGCCAGGTACTGGCCACGTTATTTAGTCCGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32840
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Essential Splice Site 348 362 13 14
ENSDART00000085132 Essential Splice Site 470 511 13 14
ENSDART00000146360 Essential Splice Site 469 510 15 16
Genomic Location (Zv9):
Chromosome 2 (position 7556590)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7974244
GRCz11 2 7772249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCAGCAGTATTGGTGATGGGTTCCCAAATCTCTTCTTGTGTACTGCA[G/A]AGCGGTGCTTTAGTCAACAGCTACAGAGGGACCGGCGGTATTTTTGAAGT
Long Flanking Sequence:
ACCAGCACACGTGACCTCTTGTTAGAAAGTAATTCTGTCATTCTGAGATCATAATAATTCAAAAGGTGATGATAATAGTTAAACATGGCAGTTTGTTCATGTTTTAGGTTGCTGAAAGAATCGTTTGCTCCAGTTTTTTCAGGCTTCGCTCTAGCATTTGTCCATTTCTGAAAGGATGACAGTAGCGATATCCTTTGACATTTTGATTAATCCCTCTGCTTTACTTACTGTATATGTTGCAGTTTGTTATTCCATTTAGAAAGATATTTCATTTACGCCACTACAGTTGCAGCTCTAAGTTGTGCTTTTTTTTGAAGGTATTAAAAAGGTATTAAATTCAACTTCAGAAGTTCTGTATATACCCTGAAAAAGCAAGCTTTGTGTAAAAGCTGATTCTACTTGTCATTTCTTCTCAATATAATGTGCAGAATAAAAGTAGAGATTTTCTAACATTCAGCAGTATTGGTGATGGGTTCCCAAATCTCTTCTTGTGTACTGCA[G/A]AGCGGTGCTTTAGTCAACAGCTACAGAGGGACCGGCGGTATTTTTGAAGTATGCTGGAACTCCACTGGAGACAAAGTGGGCGCAAGTGCATCAGACGGATCGGTGAGTTTCACTACAGCCATGTTGTTTCACATTAGAATGAATCGTCTCATACATTGTTAAAGGGGGGAACCTATTATGCAATTTATAAGGGGTTTAAACACCGTTGTGTGCTAACAGTGTGTGAATATAGCCAGCCTTTAATGGTAAAAATTATTTTTTTGTATTTTATTATAATCACACTAAAAAATAAATAAGTCTTCAGAAATCTCTTGACATTCTCCCTTTATACATGTCATCGGAAGGGGAAAGCCATGCGCATTAATGACGATGTCTTCCTCATTAGCATAAACAGCCTTGAGTGAGAAGCAGCCATCCGTCATTAGAGTTTTGAATCTGCCACTATGGTGACACAAAGCCATGTATAGCTCCGCCTTCTTTTTAAAAAGTGCTGGGAGCAC
Associated Phenotype:
Not determined