Busch Lab

ZMP

slc8a2a

Ensembl ID:
ENSDARG00000008912
ZFIN ID:
ZDB-GENE-060531-155
Description:
solute carrier family 8 (sodium-calcium exchanger), member 2a [Source:RefSeq peptide;Acc:NP_0011167
Human Orthologue:
SLC8A2
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 2 [Source:HGNC Symbol;Acc:11069]
Mouse Orthologue:
Slc8a2
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 2 Gene [Source:MGI Symbol;Acc:MGI:107996]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33653 Nonsense Mutation detected in F1 DNA Not yet available
sa7572 Missense Mutation detected in F1 DNA Not yet available
sa9489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33653
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Nonsense 45 891 1 11
ENSDART00000145182 Nonsense 7 859 1 12
Genomic Location (Zv9):
Chromosome 5 (position 38471043)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36270727
GRCz11 5 36870880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGTAGTGCTGATGGACCCAAGAAACCCTGCTTTGAGAAAGTCAAGTG[T/A]CAGCCAGGGATTCTGCTTCCTGTGTGGCTGCCGCATGACCCCCCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7572
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Missense 105 891 2 11
ENSDART00000145182 Missense 67 859 2 12
Genomic Location (Zv9):
Chromosome 5 (position 38473790)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36273474
GRCz11 5 36873627
KASP Assay ID:
554-4302.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTACCCATACRGTGTTATTCTGTGTCCTATAGGAGAAAGARGTGACTG[T/C]GACCGGTGCAAATGGAGAGAAGACCGTAATGACTGTAAGAATCTGGAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1244
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Nonsense 285 891 4 11
ENSDART00000145182 Nonsense 247 859 4 12
Genomic Location (Zv9):
Chromosome 5 (position 38478604)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36278288
GRCz11 5 36878441
KASP Assay ID:
554-1159.1 (used for ordering genotyping assays)
KASP Sequence:
GAAGGGGAACTGGCACCCAGAGGCATTGATGCGATTATGGGAGAAAAATA[T/G]CAAAACAACACCACAAGCGTTGATATGGAGAAAAATAAAGAACCTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9489
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Nonsense 543 891 6 11
ENSDART00000145182 Nonsense 505 859 6 12
Genomic Location (Zv9):
Chromosome 5 (position 38484070)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36283754
GRCz11 5 36883907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCCGGTGAACCGRACGTCAGGTGTGCGCGGGACTGTGATGATTCCCTA[T/A]CACACAGAGGACGGCTCTGCGCGACARGGGGTTGACTATGAGCAAATACA
Associated Phenotype:
Not determined