Busch Lab

ZMP

si:ch211-241e1.5

Ensembl ID:
ENSDARG00000008906
ZFIN ID:
ZDB-GENE-030131-6298
Description:
hypothetical protein LOC567583 [Source:RefSeq peptide;Acc:NP_001119897]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa8573 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8573
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101107 Nonsense 509 542 3 3
ENSDART00000137477 Nonsense 509 542 4 4
Genomic Location (Zv9):
Chromosome 2 (position 1125873)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1071694
GRCz11 2 942102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGGAAAGCTRAAAAGGSGTACTTGTGAAAYTTCAACAGRRGCTGAAAGA[C/T]GAGAGAAGAACGGAGAGAAGCTGTACTACTGCTCTACATGCGGGATGAGT
Associated Phenotype:
Not determined