Busch Lab

ZMP

smarca2

Ensembl ID:
ENSDARG00000008904
ZFIN ID:
ZDB-GENE-030131-5964
Description:
probable global transcription activator SNF2L2 isoform 2 [Source:RefSeq peptide;Acc:NP_001038240]
Human Orthologue:
SMARCA2
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 [S
Mouse Orthologue:
Smarca2
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 Ge

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa26560 Nonsense Mutation detected in F1 DNA Not yet available
sa33690 Nonsense Mutation detected in F1 DNA Not yet available
sa2224 Nonsense F2 line generated Not yet available
sa33691 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20515 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26560
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 148 1568 4 34
ENSDART00000113738 Nonsense 148 258 4 5
ENSDART00000136002 Nonsense 148 170 4 4
Genomic Location (Zv9):
Chromosome 5 (position 46801888)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44583153
GRCz11 5 45183306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCGGAGCATGTGCCTAGCCCCATGTCAGGAGGAGGGCCGACCCCGCCA[C/T]AAATGTCCCAGGGTCAGTCGCCCATGATGCCAATGGATCCGCAGGGGATG
Long Flanking Sequence:
TACATAATTACACTCAGTCAAATAATCTGCAATGATAAGGAATATGGTTACTTACTGAGATGTTAATGCACCGCAATACCACACAAAGAAAGGACGGGCTTTGAAGAAATTCTTAATGTGAGGAAAGCTCGTTATAGTGCACTCAAAATGTCTGAACAAGTTCAACCCACGCATGTGTGAGGCAGGCAGTTCAGTACAATTACATAATTTATTGGCATAAAGATATCAGCCTAATTTTGAGAACGGACCGATAACATAAAAAAAAAAAAAAAAAATCTATCGGCCGATAACAATATAGCCGCCAAGATATATTGTGAATCCATACTAGAGAATCAAAGCAAAAGAAAAACTGATAAATTTGACAGCACGTCGCATCATTTCTACAGAATACATCTTTCCTCTTTTGCTTTTTAGGATACATGTCGCCTCACCCTTCACCGATGGGCCAGGTGCCGGAGCATGTGCCTAGCCCCATGTCAGGAGGAGGGCCGACCCCGCCA[C/T]AAATGTCCCAGGGTCAGTCGCCCATGATGCCAATGGATCCGCAGGGGATGGGACAGCAGGCCAGGGGTCAGTCTGCCTTCAGCCCAGTCCAGCTACAGCAACTCAGGGCTCAGATCCTGGCGTACAAGATTCTGGGACGAGGCCAACCTCTGCCTGAAAACCTGCAGTTAGCTGTGCAGGGCAAGAGGAGCCTTCCCACCATGCAGCAGCAGCCCGTCAACACCGGCCCCTTCAACAGACCTCCAGGTGAGTCTGAGTTTATTATATAGTATTTATTTTAAGTTGTGCAGTTTTATTAGTTTTTTTACAGGGCTTGAAGATAACGTTTTACTTCGTAGCACCTGGGCTCTGAACTTCAAAAATTTAGGAACACCACAAAGAATTTAGGAGCACCCACCTAAAATGAAGGAGCACCAATGCAAATTGTATAGGTTGGTGTCACATGACGTTATTGATGACGTGAGACTCTTTTATGAAGTGATTCTTCCACATAGAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 317 1568 6 34
ENSDART00000113738 None None 258 None 5
ENSDART00000136002 None None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46811231)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44592496
GRCz11 5 45192649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCTCCCTCACCTCCCAGCCCCAACCTCAACCACCGGCAGGACCTGGG[C/T]AGCCCTCCCTCATTATCCAGCTCCAGCAGAAACAGAATCGCGTTACCCCC
Long Flanking Sequence:
ATTGAACTTGATTTGAAATGGGTTGTTTGAGTCTTTATAAAGATTTTTTTTGTATTTCATAAGTACACGTTAGTTCAAACTATGCTTTGAACTGTCTAAACCTGTCAACAAGCTTTGAGGATCTCTTCTGAGGATGATCAAACATATAAACGACAATGGGCTTCTGAAATATAAATCACACCACTTATGCCTTTTCATAGTGTTACGTTATGTTGATGGTATTGACGAAATCCTTATGTTTCACTGGGAGCATTTTGCATCCAGGAGCATTTCTTTGACTGGCCTGACATTTGAAAAATCTCACAAGATGTTTGCAAAGTGCATCTCTTTTATTTTCAGGTCAAGGTGCAGAGACATCCAGTACACCACAGAAGCTGTTGATCTCGGCTCCCAGTGGCAGACCCTCTCCAGCTCCCCCGCTGGCTCCTACCGGGACACAACCTGTTCCCAGCACCTCCCTCACCTCCCAGCCCCAACCTCAACCACCGGCAGGACCTGGG[C/T]AGCCCTCCCTCATTATCCAGCTCCAGCAGAAACAGAATCGCGTTACCCCCATTCAGAAGCCTCAGGGTCTGGACCCCGTCGAACTCTTGCAAGAGAGAGAATACCGGTATGTAATGAGTAATTAAATTCCGCTTATACTGCCCTACACTGGCTAAATGTCATGAATTTTATTTTCTTTTTGCGGTGATGTTTCCTGAGGTGTTCTTTTGATTGAAAACATGTTTATTAATTTTCCATCATGTTTTTTTTGTCATGTGATTAACCACCTCATTAAAATTGTACATTCAGGATGCTTTTCATAACATTTAAAATAAAAAAACGCAATGCTCTCAAAGATTGCCTGTATATGATTTATGTGGAATCAAACAGACCTTTTGTAAAATTATGAGTCCATTATGAGAAGCTAAGTGAACGGTTACTTCAAAGTTGATGCTTCCCACATGAAAAATACTGTATTTAGTAAATACCACTGTAAAATACTTAAATTCATCTGTTGTGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3529
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Essential Splice Site 352 1568 6 34
ENSDART00000113738 None None 258 None 5
ENSDART00000136002 None None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46811339)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44592604
GRCz11 5 45192757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCTCAGGGTCTGGACCCCGTCGAACTCTTGCAAGAGAGAGAATACCGG[T/A]ATGTAATGAGTAATTAAATTCCGCTTATACTGCCCTACACTGGCTAAATG
Long Flanking Sequence:
CAAGCTTTGAGGATCTCTTCTGAGGATGATCAAACATATAAACGACAATGGGCTTCTGAAATATAAATCACACCACTTATGCCTTTTCATAGTGTTACGTTATGTTGATGGTATTGACGAAATCCTTATGTTTCACTGGGAGCATTTTGCATCCAGGAGCATTTCTTTGACTGGCCTGACATTTGAAAAATCTCACAAGATGTTTGCAAAGTGCATCTCTTTTATTTTCAGGTCAAGGTGCAGAGACATCCAGTACACCACAGAAGCTGTTGATCTCGGCTCCCAGTGGCAGACCCTCTCCAGCTCCCCCGCTGGCTCCTACCGGGACACAACCTGTTCCCAGCACCTCCCTCACCTCCCAGCCCCAACCTCAACCACCGGCAGGACCTGGGCAGCCCTCCCTCATTATCCAGCTCCAGCAGAAACAGAATCGCGTTACCCCCATTCAGAAGCCTCAGGGTCTGGACCCCGTCGAACTCTTGCAAGAGAGAGAATACCGG[T/A]ATGTAATGAGTAATTAAATTCCGCTTATACTGCCCTACACTGGCTAAATGTCATGAATTTTATTTTCTTTTTGCGGTGATGTTTCCTGAGGTGTTCTTTTGATTGAAAACATGTTTATTAATTTTCCATCATGTTTTTTTTGTCATGTGATTAACCACCTCATTAAAATTGTACATTCAGGATGCTTTTCATAACATTTAAAATAAAAAAACGCAATGCTCTCAAAGATTGCCTGTATATGATTTATGTGGAATCAAACAGACCTTTTGTAAAATTATGAGTCCATTATGAGAAGCTAAGTGAACGGTTACTTCAAAGTTGATGCTTCCCACATGAAAAATACTGTATTTAGTAAATACCACTGTAAAATACTTAAATTCATCTGTTGTGGTATGTCTAATGTTGCTGTGTTGATACAATAAGTATTTATTATACTACATCACAGTTTACTAAAACTGTTATAAAAACTGTTGAGTCAGCTGTAGATAATAATACAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2224
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 405 1568 8 34
ENSDART00000113738 None None 258 None 5
ENSDART00000136002 None None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46818146)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44599411
GRCz11 5 45199564
KASP Assay ID:
554-2838.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTTTCTTTCTTTTTCAGCTGAGGCTAGATGTTGTAGCCTGTATGCGC[C/T]GAGACACAACTCTTGAAACAGCCCTGAACTCCAAGGCATACAAGCGCAGC
Long Flanking Sequence:
AATTCATACAGTTTAACATAAAGGCTTGTTTCTAATAGCCTAACTTATTACGCTCATCTGCTAGGAGACACTTCTAATGGAAATCTCTCACTTTTTTCATCTGTGCTTTAGACATAATGAAATAATTTAAAAGAAACCAAGTGGAAATTGCTTATGCATATATTTGATTTCCAGGTGTCATTGAGCTTTTTCCCTATTCACATTGTTTGGATGGAGATGGTGTCTGAAGTTGTGCCTTGAATGTTTAATTTACTCAGTGTAATGCATCGAACCTTTAGAGGGCGCCCTTGTTGTATTTGGAAAACAGGCTCCTCAATTCACGGCCTTGTTGTGCTGTAATTACAAACAATTACGGGCAAAATATGTGTGAAATGCATCAGAATATAATTATCATTTGATGAAGCTTATTAGCTTAATGCAGTTTGCCACAGATGATGATGATGATTGATTTTTTTTTCTTTCTTTTTCAGCTGAGGCTAGATGTTGTAGCCTGTATGCGC[C/T]GAGACACAACTCTTGAAACAGCCCTGAACTCCAAGGCATACAAGCGCAGCAAGAGACAGACGCTGAGAGAGGCTCGCATGACAGAGAAACTGGAAAAGCAGCAGAAGATCGAACAGGAGAGAAAGCGCAGACAGAAACATCAGGTGATCGATAATTGATCAGTATATCAAGTGTGACCTATAGAACTATACTACTGATAAAAAACAGACAGAGCTTCTAGCATGTTCTTTGTTGTATATGCACTGCCTGACAAAAGCATTGTCTCTTATCCAAGGTTTTTAGGAACAACAAATAATAACTTGACATCTAGTTGATCATTTGGTATCAGAAGTGGCTTATATGAAAGGCAAAGGCCTCTTGATCAAATAAAATATGATCATGCCTTGATTTTTAATTATTTAATTAGGGAAGTCAGGTCTTACTTTGCTTAGATAAAAGTCTTGTCACTTAACTGGAATAATGTACATTATAGATAGCATGATAGATATAAAGTCATGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6061
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 728 1568 15 34
ENSDART00000113738 None None 258 None 5
ENSDART00000136002 None None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46837362)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44618627
GRCz11 5 45218780
KASP Assay ID:
554-3815.1 (used for ordering genotyping assays)
KASP Sequence:
TAGAGAGGGTGGATAAACAGTCAACCTTCCTGATCAACGGGACCCTCAAA[C/T]AATACCAGGTACTGTTATACCAAGTAACGGTTAAAGCCAACTCTGWATAG
Long Flanking Sequence:
CGGCAGTTGCTCTGTGTAATGAAAAAATAATAATTTGATAAATTTTTGATGCTTGAACATTTTCATTACTTAGACCTTTGGTGAAAGACAGATATCATAATACAATATTAAACCCTGTCATCGTCAACATTAGTGTAAGTCAGGGGTGTCTAAATTCGGTCCTGGAGTGCCGACTTGCTTCAACATACCTGCAGGGATGTTTCTAGAAAGCTTAGAAAAAGCTTGATTAGCTAGGCCAGCTGTGTCTGATTGGGGTTGGAACTAAACTTTGCAGGACACCGGCCCTCCAGGACCGAGTCTAGACATACTTGGTGTAAGTGATTAAGGATTTTTTTAACTTTATTTTTGTACTCCGTTACAGGTCTGCTAAGCAGGATGTGGATGATGAGTACAGCAGTCAGGCAGGACAGACCAGCTCCCAGTCTTACTATGGAGTAGCCCACGCGGTCATAGAGAGGGTGGATAAACAGTCAACCTTCCTGATCAACGGGACCCTCAAA[C/T]AATACCAGGTACTGTTATACCAAGTAACGGTTAAAGCCAACTCTGTATAGACTCCTCCACTAATATATCGTTCTCAGAATCCATCTGCTCTGAAGAGAACTGTGTATGTTTAAATGATATTTCAAGAGATTATACTCTTGAAATGAAAAGGGCTGGAGGAAAGAAATCGTACTGAGAGGAAATATTAAAAATTGAGTGGTGTGTATAGAATCTTTCATCCCTTTTGAGTGGTAATGGATTTCAAACTGCGAAAACAGGCCTCTTATCTCCTAATTTTCTATTCTGCACTACCTGATTGCTGGGGTTTTGTAAAGAAAACTTCAGGGAGACTGTTTATCCTTTGAAAGAACTAAGCAAGCACTAGCATTCATGCTTTGATTCCACTTGGCAGCTGCGAAACACCAATTGGGTCTATTGTGCCGTGTTGTTCAGTGAACAATTGTGCAATCCGTGAGTCATGAGTCTGCTCGGTTGTCTGTTTGTGATGCTTTTAAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33691
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Essential Splice Site 1044 1568 23 34
ENSDART00000113738 None None 258 None 5
ENSDART00000136002 None None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46848959)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44630224
GRCz11 5 45230377
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAATCCTTTGCTGAACATTTGGGATTTCCAAATGGCATTATCAGCGGG[T/G]GAGTATACATCAAATCGAGCGTTACATAACCTTAAGAGTTACCATGAAGT
Long Flanking Sequence:
TATTGGTGAAGTGAAGAGACAGTGATAGAGCCAATTCTGTGGAAGGGGATGATTGGGAGGCCATGATCGTAAGGGCCGATAGGGGGACTTTGGCCAGGACACCGGGGTTACACCCCTGCTCTTTCACGAGAAGTGCCATGGGATTTTTAATGACCACAAAGAGTCAGGACAGTGTTGTGTCCCCTTCACTTTTTCTGGGGCATTAGGACTCACACAGACCACAAGTTACCAGAAGGCAAAGTATCATAGACGCTGCGGTGAACACTGTGGTTTCTGTGGTTACTGTCATTCCTCTGCAGACAAAAAAATTGCAGTTATCGCCACAGCCATAAACTGTATGTAAGCCTTGTTAGTTGTTCAACGAGCAGTGCCACTGTAATAAACAGTCAGTATTTTTTTCCTACTTGTATAGCATGAGCTACACTAAAAGCATCTTTTTTGTATCTATTCAGGAATCCTTTGCTGAACATTTGGGATTTCCAAATGGCATTATCAGCGGG[T/G]GAGTATACATCAAATCGAGCGTTACATAACCTTAAGAGTTACCATGAAGTGTTCATTCATGTCAATTATGGATCACTAAACTGACCGCGGGCTCTGGACAGTGGAGGTACACCATCATAGATTTGACATTAGCGTTGTGCTTTTTTTTTTCTTGTCCACCTAGCCCTGACCTGTACCGAGCCTCTGGCAAGTTTGAGTTACTGGACCGCATCCTGCCCAAACTGAAGGCCACCAATCACAGAGTGCTTTTGTTCTGCCAGATGACCTCCCTCATGACCATCCTGGAGGATTACTTTGGCTACCGTAACTTCCTTTATCTGCGTCTGGACGGTCAGTAATCAGCGCAGTCCTTCTTTAATGTTTTCCTGTCCTTTAGGGCCTTATTTCTTGGGGGTTTCCAATTGGAAATTTTAATAAGTGTGATCACACAAACATGCTGCCCTTTCTCTTTCATTAACACTCCTTTGCTGCTGGTTTTGTCCTCCAGGAACTACAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 1053 1568 24 34
ENSDART00000113738 None None 258 None 5
ENSDART00000136002 None None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46849148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44630413
GRCz11 5 45230566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTTTTTTTTTCTTGTCCACCTAGCCCTGACCTGTACCGAGCCTCTGGC[A/T]AGTTTGAGTTACTGGACCGCATCCTGCCCAAACTGAAGGCCACCAATCAC
Long Flanking Sequence:
TTTTTCTGGGGCATTAGGACTCACACAGACCACAAGTTACCAGAAGGCAAAGTATCATAGACGCTGCGGTGAACACTGTGGTTTCTGTGGTTACTGTCATTCCTCTGCAGACAAAAAAATTGCAGTTATCGCCACAGCCATAAACTGTATGTAAGCCTTGTTAGTTGTTCAACGAGCAGTGCCACTGTAATAAACAGTCAGTATTTTTTTCCTACTTGTATAGCATGAGCTACACTAAAAGCATCTTTTTTGTATCTATTCAGGAATCCTTTGCTGAACATTTGGGATTTCCAAATGGCATTATCAGCGGGTGAGTATACATCAAATCGAGCGTTACATAACCTTAAGAGTTACCATGAAGTGTTCATTCATGTCAATTATGGATCACTAAACTGACCGCGGGCTCTGGACAGTGGAGGTACACCATCATAGATTTGACATTAGCGTTGTGCTTTTTTTTTTCTTGTCCACCTAGCCCTGACCTGTACCGAGCCTCTGGC[A/T]AGTTTGAGTTACTGGACCGCATCCTGCCCAAACTGAAGGCCACCAATCACAGAGTGCTTTTGTTCTGCCAGATGACCTCCCTCATGACCATCCTGGAGGATTACTTTGGCTACCGTAACTTCCTTTATCTGCGTCTGGACGGTCAGTAATCAGCGCAGTCCTTCTTTAATGTTTTCCTGTCCTTTAGGGCCTTATTTCTTGGGGGTTTCCAATTGGAAATTTTAATAAGTGTGATCACACAAACATGCTGCCCTTTCTCTTTCATTAACACTCCTTTGCTGCTGGTTTTGTCCTCCAGGAACTACAAAGTCAGAGGATCGTGCGATGCTTTTGAAGAAATTCAATGAGGAAGGCTCCCAGTATTTTATCTTCCTGCTGAGCACCAGGGCGGGAGGTTTGGGGCTGAACTTGCAAGCTGCAGACACTGTTGTGATCTTTGACAGCGACTGGAACCCCCACCAGGTTTGTGTGATTCACTGCTGTGATTAGAGAGGAACTAG
Associated Phenotype:
Not determined