Busch Lab

ZMP

mylipa

Ensembl ID:
ENSDARG00000008859
ZFIN ID:
ZDB-GENE-030131-7831
Description:
E3 ubiquitin-protein ligase MYLIP-A [Source:UniProtKB/Swiss-Prot;Acc:Q6TEM9]
Human Orthologue:
MYLIP
Human Description:
myosin regulatory light chain interacting protein [Source:HGNC Symbol;Acc:21155]
Mouse Orthologue:
Mylip
Mouse Description:
myosin regulatory light chain interacting protein Gene [Source:MGI Symbol;Acc:MGI:2388271]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa43288 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43288
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013497 Nonsense 406 472 6 7
Genomic Location (Zv9):
Chromosome 19 (position 26861506)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26791618
GRCz11 19 26375841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGATTGACGCCGCCTTCTGCCCCTGCGGACACATGGTCTGCTGC[C/T]AGAACTGTGCTGCTCAGTTGCAGGTCAGACAACTTTCAGCTTCATTTAAT
Associated Phenotype:
Not determined