Busch Lab

ZMP

zgc:56223

Ensembl ID:
ENSDARG00000008784
ZFIN ID:
ZDB-GENE-040426-947
Description:
hypothetical protein LOC393182 [Source:RefSeq peptide;Acc:NP_956507]
Human Orthologue:
PRPF4B
Human Description:
PRP4 pre-mRNA processing factor 4 homolog B (yeast) [Source:HGNC Symbol;Acc:17346]
Mouse Orthologue:
Prpf4b
Mouse Description:
PRP4 pre-mRNA processing factor 4 homolog B (yeast) Gene [Source:MGI Symbol;Acc:MGI:109584]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31285 Nonsense Available for shipment Available now
sa19802 Essential Splice Site Available for shipment Available now
sa15327 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31285
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762 Nonsense 205 490 2 5
ENSDART00000098834 Nonsense 247 986 2 15
Genomic Location (Zv9):
Chromosome 2 (position 32542697)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32841604
GRCz11 2 32824822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAAATCAGCGAGAGACCTAGTGGTCCCAGTGAAACGAAGGAAAGGAGA[C/T]GATCAAGGAGCACTGACAGATCCAAAGATAGAAGTCGTAGGTCCAAATCT
Long Flanking Sequence:
AACACAAACATAAGCGGAAACACAGAGACTCTTTCCGCGATGATAGAGAATGTTCTACTAGCTATGAAGGTGCAGCCGACTCACCAAAGCGATTCAGACTTGATGACCTTGCTGCTCTGGAGGATCTGGAGAAACAGAGGGCCATGATTCAGGCAGAGCTTGATAATGAGCTGATGGAAGGGTCTGTGCAGTCAGGTATGGGGCTGATATTACAGGGTTATAACTCTGATTCAGAGGACGGGGAGGTCCAGGAGGCTGTTCGAAATGGTGAGCAACAGAGAAAAGATCTCGATGAGCTTGTAACGGTTAAGGGGAATGGCAGAAAATTGCAACAGGATTATGTAAACGATGAACAATTTTATTCTGTGCTTGAAGGCAGAACCATGTCTGAGGAGGTGACAGTCCAGAGCCATAAATCTGAAAAAAGAGAGAGTATGACTGGGTTAGGTATTAAAATCAGCGAGAGACCTAGTGGTCCCAGTGAAACGAAGGAAAGGAGA[C/T]GATCAAGGAGCACTGACAGATCCAAAGATAGAAGTCGTAGGTCCAAATCTCCTGTGAAATCTAAAGAAGTGCCATCGTCATCAGCCACAAGCAACAGAAAATCAAATACACGGCCTGAAGAGCAAGCTGTAGACCACAGATCCTCATCAAGAAGCAGCAAATCTGGTTCTAAAGAAAGAAGCACCAGCTTGCCAGAAGTTGACAGAGACAAGAAACCAGTAAAGGCCCCCTTAAAAGAAGTCTCTTCTGGGAAAGAGAATCGATCTCCTAGCAGAAAACAAGGTCCAGATCGACTTAGCCCAACTGTGCAGCCCAGGAGCCACCGCTCACCTGAACGCCTACCTGTTGTTCAGAACACAGACAGGGCATCCAGACAGGACAGATCTACGTGCCACAATAGATCCCCTCCGAGGAGAGGCAGATCTCGGTCAGTTGAGAGGAGACGGAGAGAAGAAGAGCGCCAGAGACTCTCTAGTGACAGGTTACTTTCTGTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19802
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762 None None 490 None 5
ENSDART00000098834 Essential Splice Site 503 986 4 15
Genomic Location (Zv9):
Chromosome 2 (position 32539363)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32838270
GRCz11 2 32821488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTCTGAAGGAATGAAGGCTGAGCAGGAGGACTCGGATGAGGAAGT[G/A]TGAGTATCAAGGAAAGCTGTTTTGCTTTTTATGTTGTGGATGATATTTAG
Long Flanking Sequence:
TTTAATTTAATTGTATTATCTCTCAATTTCTAAATATATTCGGTGACTTAAATATTATTTTAATAAATATATTTGTTTCAGTTTTTTTTTTCAAATGCAACAAAATACATTGCCTATATTCACTGAGAAATGGATAAAAAAATATTCATTTTCAAAATGGGCTGTACTCAATTATGCTGAGCACTGTACGTATAATTCTTTCATTACAACTAGGCTTTTCAGTGACACTTCTGGGATGTCATATTATTTACATTTGTATTATATTCTGAATGTTAAATAGATTAAAAATAGGTGTGAGTCATTTTATCATCTCCCATTGTAATTAAACTTGCATTAATGGTGTGCACATCTAGGGAACGTGACAGGATGGATCGCAGGCAGCCGGTGCGTTCGAGATCGCAGGAGAGGCGGAGAAGAAGGAGCAAGGAAAGAGAGGACATGTTTAAAGGCAGTCTGTCTGAAGGAATGAAGGCTGAGCAGGAGGACTCGGATGAGGAAGT[G/A]TGAGTATCAAGGAAAGCTGTTTTGCTTTTTATGTTGTGGATGATATTTAGATTGATCATGAATGCTTATCTTTGTCCAGGCTGGAGGATTATGACGTAGATGAAGAGGACGAGGAGGCTTTGATAGAGCAGAGGAGACTTCAGCGCTTGGCCATAATGCAGGTCAGAATACTTCTAATTCCTGCAGTGGCTTCTACTTTGTTTTAAGCATAAACTAGTGTTCAGTTTGGATTGGGTAAAAACATTGTTATTCAGTTTATACAAAGTGACAGAGATTTGTAATGCTAGAAAAGATTTTAGTATCAAACAAATTATCTATTTTATTTCATAATACTAAGCAGCACAAGTGTTTCTTATTTCTTTAGCACCAAATCAGCACACTAGAAGGATTTCTGAAGGCATACTAAAATCTGGAGTAATGGCTGCTGAAAATTCATTTGATAATGGGAATAAAATAGCTTTTTCCCAGTATTACTGTTTTTATGTGTGTTTTTTTTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15327
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762 None None 490 None 5
ENSDART00000098834 Nonsense 575 986 6 15
Genomic Location (Zv9):
Chromosome 2 (position 32538636)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32837543
GRCz11 2 32820761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCMCCTGATGACATTCTTGAGCGTGTGGCTGCTGATGTCAAAGCYTA[T/A]GAGCAAGAGAACCTGGACACATTTGAGGATAATGTGAAGGCCAAGTATAG
Long Flanking Sequence:
TGGATTGGGTAAAAACATTGTTATTCAGTTTATACAAAGTGACAGAGATTTGTAATGCTAGAAAAGATTTTAGTATCAAACAAATTATCTATTTTATTTCATAATACTAAGCAGCACAAGTGTTTCTTATTTCTTTAGCACCAAATCAGCACACTAGAAGGATTTCTGAAGGCATACTAAAATCTGGAGTAATGGCTGCTGAAAATTCATTTGATAATGGGAATAAAATAGCTTTTTCCCAGTATTACTGTTTTTATGTGTGTTTTTTTTATCAAATAATGCGGCCTAAATATGATGTTAAAAATATTTTACAACCACCTGATCTTTGAGTATTGTTTGATTGTATTTGCATTGTGTCTTGTACAGAAATATAAGCCAGTGAATGAGGACAGCAATATGTCAGGACTCTCAGATCACGGCAGTCCTCAGAGTAGCACTCACAGCCGGTCCCCATCCCCTGATGACATTCTTGAGCGTGTGGCTGCTGATGTCAAAGCCTA[T/A]GAGCAAGAGAACCTGGACACATTTGAGGATAATGTGAAGGCCAAGTATAGTCTCGTCTCCCAAGAAAAAAATGGTATGTCATCTGGAAAGAAAATTGAATTGCATTATAATTAATGTCCAGAGCTGCATGAGCTTTTTTCTTTTGAACATCATATAAGACATTTTAAAGCAGTGGTCTTAAAATAAATTCCTGGAGGGTCGCAGTTCTGCATGGTTTAGCTCCAACCACCTCCAATTCACACCTAATATTTCATAGTAGTCTTGAACACTTTGATTAGTTGGATCAGTTGTGTTTGATTAGGGTTGGAGCAAAACTGCAGAGCTGCGGCCCTCCTGTAATCCAGTTACAGACCTATATTTTAAAGAATGTGGGTAAGCATTAAATCAGCTCTTTGACTTGATTAAAAAAAGAAAAGAAAAGTGGAACCATTTACCGTTTTGTTACAAACATTATGCAAAATATCTTTATTTTTCAGCAGAAGAAAAGAAACTCATATAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5149
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762 None None 490 None 5
ENSDART00000098834 Essential Splice Site 890 986 13 15
Genomic Location (Zv9):
Chromosome 2 (position 32532490)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32831397
GRCz11 2 32814615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACATGCTGAAGCTCAACATGGACCTCAAAGGAAAATTGCCTAATAAGG[T/A]AAGTGCRTCAGGTATGAAGAATTTGAATTAAACTATGACATAATTTAGTA
Long Flanking Sequence:
GAAATGAACAAATAAAGCAGATGTGCTTCATTTATAGATTTGAAGAGACGGTTTACCCTCAAGTAGTCTAACACAAACCTCTTTTTCGGTAGAACGTTATCGAAGGTATTTTTTCTTTAGCTGAATAACAGTTGTGGCCATTGGTGATTAATAATGAAAGTCTGTGGCTAACGGCTCCTTGAGAGAAAAAAACAAGCATAACAAAATCATTACCAGTGGTTCTTGATAATACATTGACTTCCATTAAGATGAAACTCCTTTTGCATATTGAGAATTAAGAGTTTCAGGTAACCCAACCTGATTGTTGGTGAAACTTGATTTTAAGTTTTTCTTCTCCTTTTTTGCAGTCATTGGAAAGTCATATGATTACGGAATCGATATGTGGTCTGTGGGCTGCACTCTCTATGAACTATACACAGGAAAAATCCTTTTCCCCGGCAAGACCAATAATCACATGCTGAAGCTCAACATGGACCTCAAAGGAAAATTGCCTAATAAGG[T/A]AAGTGCATCAGGTATGAAGAATTTGAATTAAACTATGACATAATTTAGTAAAATATAACCTTCAAATATACCAAATAATCTTTATTCACAGATGATCAGGAAGGGTCTGTTCAAGGACCAGCACTTTGACCAAAACTTGAACTTTTTGTACACTGAGGTTGATAAAGTCACTGAAAGGGTAAGGGTTACATATTTCATTCACTTTAAATGTAATAGCAAACTTACTCATACACTATTTTGAAACAACTTATTTTCCTGAGGATTTCGCGAATGCTTATTGCTATTGTCATAAAGTTGAAGAACCCAGCCCAGGAGACTTGGTACAAGCAAAATTCTTTGAGGTGTGTTGGTTCTGGAACAAACAGCATCTTCAAGAAATCCACATGACTCTTAGCACAAGTCTAACAAGTCGCGCGTCTAAAACAAGTCTAATTTGTGGATAAATGTTATGAGTAGGCGGCTAAACCGTATGTAAATGTGGTAGATAGTTCCAGAACCTG
Associated Phenotype:
Not determined