Busch Lab

ZMP

si:ch211-159p3.3

Ensembl ID:
ENSDARG00000008548
ZFIN IDs:
ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-070912-125
Description:
Rho GTPase activating protein 12a [Source:RefSeq peptide;Acc:NP_001119879]
Human Orthologue:
ARHGAP12
Human Description:
Rho GTPase activating protein 12 [Source:HGNC Symbol;Acc:16348]
Mouse Orthologue:
Arhgap12
Mouse Description:
Rho GTPase activating protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922665]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa33007 Essential Splice Site Available for shipment Available now
sa25119 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19855 Nonsense Available for shipment Available now
sa18172 Essential Splice Site Available for shipment Available now
sa17967 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25892
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Nonsense 69 831 1 17
ENSDART00000135836 Nonsense 23 488 1 10
ENSDART00000138620 None None 261 None 7
ENSDART00000142804 Nonsense 69 831 2 18
Genomic Location (Zv9):
Chromosome 2 (position 43812465)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43897966
GRCz11 2 43750964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGATGCCAGTAAGCCATTTTATGTTCCAGCGCAGTATGTACGAGAGGTG[C/T]GACGGGCACTCATGCCCCCTCCTAAACCCCTGAATATAGCAGGCAGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33007
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 445 831 6 17
ENSDART00000135836 None None 488 None 10
ENSDART00000138620 Essential Splice Site 240 261 6 7
ENSDART00000142804 Essential Splice Site 445 831 7 18
Genomic Location (Zv9):
Chromosome 2 (position 43841044)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43926545
GRCz11 2 43779543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCCGCGCCGCAAAACCACCTTGCGCTCTCACCCTTATTTTCCACAAG[T/G]CAGTGTTGCCTCGCCACTATATTCCAGCCGCCAATCACATCGGATGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 466 831 None 17
ENSDART00000135836 Essential Splice Site 370 488 None 10
ENSDART00000138620 None 261 261 None 7
ENSDART00000142804 Essential Splice Site 466 831 None 18
Genomic Location (Zv9):
Chromosome 2 (position 43845521)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43931022
GRCz11 2 43784020
KASP Assay ID:
554-7400.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCCACTTTAAACATGACTAAAATCACTGAACATGGAAAGAAAGTCCGG[T/A]AAGTAGAACCAATCAGGTAGAGAGAGAGCTAGAAATGCTTCCATCTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19855
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Nonsense 509 831 9 17
ENSDART00000135836 Nonsense 413 488 8 10
ENSDART00000138620 None None 261 None 7
ENSDART00000142804 Nonsense 509 831 10 18
Genomic Location (Zv9):
Chromosome 2 (position 43845820)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43931321
GRCz11 2 43784319
KASP Assay ID:
2259-2538.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGTTTGGAAGAGACCAGAAGAGTTCAGTGGAGTACAGTGTGGATCTC[A/T]AAGGAGGGTCGGTGGACTGGGCGTCTAAAGACAAATCCAGCAAGAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18172
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 635 831 12 17
ENSDART00000135836 None None 488 None 10
ENSDART00000138620 None None 261 None 7
ENSDART00000142804 Essential Splice Site 635 831 13 18
Genomic Location (Zv9):
Chromosome 2 (position 43853096)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43938597
GRCz11 2 43791595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGGCAGACCTACTTTACAAGCTGTCAAAGACAAAGGCTACATTAAAGG[T/C]ATTACACRCACCTATAAGCAGACACAGTKTTATGTTTAAAATTCAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 668 831 13 17
ENSDART00000135836 None None 488 None 10
ENSDART00000138620 None None 261 None 7
ENSDART00000142804 Essential Splice Site 668 831 14 18
Genomic Location (Zv9):
Chromosome 2 (position 43853286)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43938787
GRCz11 2 43791785
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTCCCCCGCTTTGTCTGGTTGTGCATTGAGCAAGTGGAGAAGAACGG[T/A]ACTTCTCAATCNTTTTTTTTGTTTTAGTAACTTTACAGGTKTTTAATATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5166
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050403 Essential Splice Site 774 831 16 17
ENSDART00000135836 None None 488 None 10
ENSDART00000138620 None None 261 None 7
ENSDART00000142804 Essential Splice Site 774 831 17 18
Genomic Location (Zv9):
Chromosome 2 (position 43856999)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43942500
GRCz11 2 43795498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCGGCCAAACCATGACACCATACAGGTTCTCTTCAAACACCTGAAGAAG[T/C]GAGTATAAAAGGAGGAGACAGAACAAATGATTATRATGGCAGTTGTGGGT
Associated Phenotype:
Not determined