Busch Lab

ZMP

dmd

Ensembl ID:
ENSDARG00000008487
ZFIN ID:
ZDB-GENE-010426-1
Description:
dystrophin [Source:RefSeq peptide;Acc:NP_571860]
Human Orthologue:
DMD
Human Description:
dystrophin [Source:HGNC Symbol;Acc:2928]
Mouse Orthologue:
Dmd
Mouse Description:
dystrophin, muscular dystrophy Gene [Source:MGI Symbol;Acc:MGI:94909]

Alleles

There are 23 alleles of this gene:

Allele Name Consequence Status Availability
sa31194 Nonsense Available for shipment Available now
sa32610 Nonsense Available for shipment Available now
sa25537 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12459 Nonsense Available for shipment Available now
sa32609 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16997 Nonsense Available for shipment Available now
sa39559 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8798 Nonsense Mutation detected in F1 DNA Not yet available
sa18688 Nonsense Mutation detected in F1 DNA Not yet available
sa19441 Nonsense Available for shipment Available now
sa11033 Nonsense Available for shipment Available now
sa32608 Nonsense Mutation detected in F1 DNA Not yet available
sa39558 Nonsense Mutation detected in F1 DNA Not yet available
sa19440 Nonsense Available for shipment Available now
sa25536 Nonsense Mutation detected in F1 DNA Not yet available
sa32607 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32606 Nonsense Mutation detected in F1 DNA Not yet available
sa239 Nonsense Confirmed mutation in F2 line Not yet available
sa19439 Nonsense Available for shipment Available now
sa13095 Essential Splice Site Available for shipment Available now
sa19438 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31194
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 160 3633 6 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10204856)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10337194
GRCz11 1 11021305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCATGGCGGACTTACAGCAGACCAACAGCGAAAAGATCCTGTTAAGCT[G/A]GGTCAGGCAGTCCCTCAAAAACTACCAAGACGTCAACGTGGTCAACTTCT
Long Flanking Sequence:
ACATAAGGATACATCTCTTGATTCTTGAAACTTATCCTGTTCATCAATATCAGGTCATGTTGTACTTTTCACCTTTCTGATAAACATGCATATACAGTTGAAGTTAAAGGCTTAACTAGGTTAATTATGCAAGTTAGGGTAATTATGCAAGTTATTGTATGTTCTGTAGACAATCTAAAACAAATATTCTTTAAGGGGGCTAATAATATTGACCTTAAAATGATTTTAAAAAATGAAAAACTGCTTTTATTCTAGCCGAAATAAAACAACAAGCACTTACTCTAGAAGAAAAAATATTGTAGGAATTACTGTGAGAATTTCCTTGCTCTGTTAAACATCATTTGGGAAATATTTTAAAAAGAATAAAAACTTCACACGAAGGCTAATCATTTGGATTTCAACTGTATGTGCATCCTCTCCTTGGCCACAGGTTAAGGATGTGATGAAAGATGTCATGGCGGACTTACAGCAGACCAACAGCGAAAAGATCCTGTTAAGCT[G/A]GGTCAGGCAGTCCCTCAAAAACTACCAAGACGTCAACGTGGTCAACTTCTCCAGCAGCTGGGCCGACGGTTTCGCTTTCAACGCTCTCATCCACAGCCACAGGTGCTTTCGCTTTCATTGAAAATCTGTTCTTTCGCCACTGATGAAACTCCAAATGAATGTTTTTATTCATTGGTCATAAACTGCATGGGTGATCACTGGCCTAAAGCAGTATTTGAAGCCGAGTGTATGAGTTATTGTTTTTCCATTTTTCCCTGTTGTTCATTTGGGTAATGAGCCAGCTGTGTTTCGATCTGCTTTTAGCTATTTCAAGCTCTGAAAATAATTTAAGTTATTAACTATCCTATAGTAATTATGTCTTTTTCTGGTTCTTTGGCAGGCCGGAGCTGTTCAGCTGGAGTGTAGTGGAGCAACAGGATAATGCCATTGAGAGACTGGATCATGCCTTCGGTGTTGCGGAGAAGAGTTTAGGAATCGACCGGCTGCTGGACCCCGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 288 3633 8 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10200507)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10332845
GRCz11 1 11016956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCTCGAGCCGCAGTGACCAAGGAGGAGCACGTCCTCTATCAAACCCAA[C/T]AGCGGTACTCTCAGCAGGTCAGACAAACACACACTCATAGATAAACACGG
Long Flanking Sequence:
CGAACCTCTTGAATGTAATTCTTGTATTGCATTGGGGTAATGTAACCCAGAGCTCTGTCATCGAATTATTCATTTGTATCCAATAAATTGTTACGATTTTTGACATTGAAGAAAAACCTCTCCAGACCTTTTCTCTTGAACACGCATGGAATTGGTTAATATTCCAACAATATACAGATTTGAACAGCAGTATCCATACACTTTATTTACACAGATTCTTTTAGATGTAAAGCAATTGGTTGTCCTCTAGTTCTCACTTGAATCTAATTTCAAAAAGACCCTAATAATCTCTCCCGTGTTTGCCATGCAATTAAGTCATTTCTTGTTTCCTTTTGGCAGATGTTGCTACAGTCCATCCAGATAAGAAATCCATCATCATGTACGTCACCTCCCTCTTCAAAGTGCTGCCCCATGGCGTGAGTTTGGAGGCCATCCAAGAGGTGGAGACCCTCCCTCGAGCCGCAGTGACCAAGGAGGAGCACGTCCTCTATCAAACCCAA[C/T]AGCGGTACTCTCAGCAGGTCAGACAAACACACACTCATAGATAAACACGGTGTGTGTGTGTGTGTGTGTGTGTAGCAATCATAATGCATTGGAGCCATTATCTCTGGCGCCACATACATCTACTATGAAAGCTTCTCCGGTTTCCAAAAGGCTTTCTGACGTTCTCAGGATGCACCTCTAGCTTGTCAACACACTTTGCCGGCCGACATTGAATTACGTTTTGTAATTTGTGATCTAATTTTGCCTCCCTGCATTCCAACGTCCTCATCGTCCTTCTCACTGCCATCTCCAGCTCATCGCTCCATCGCTCAGCTCTCCTCAATATTTCACTTCATCCATCTCTTTTGTTTCTCTTTTCTTCAGCGTTTGTCTTTTGCATCTGTTTTAGATCACAGTCAGCGTGGCCCAGAGTCGCGTTCGCAGCCCGTCGCCCTCCTATAAGCCGAGATTTAAAAGCTATGCCTTCACTCAAGCCGCCTACGTCAAGACACCTGAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25537
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Essential Splice Site 338 3633 9 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10199982)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10332320
GRCz11 1 11016431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTACGTCAAGACACCTGAACAGCAGAGGAAGTTCCTCATCGCACAGG[T/C]TTGTTTCTGTTGACTGCTCCACCATGTTGCCAAGCAGTGCAGCTGTGTCT
Long Flanking Sequence:
AAACACACACTCATAGATAAACACGGTGTGTGTGTGTGTGTGTGTGTGTAGCAATCATAATGCATTGGAGCCATTATCTCTGGCGCCACATACATCTACTATGAAAGCTTCTCCGGTTTCCAAAAGGCTTTCTGACGTTCTCAGGATGCACCTCTAGCTTGTCAACACACTTTGCCGGCCGACATTGAATTACGTTTTGTAATTTGTGATCTAATTTTGCCTCCCTGCATTCCAACGTCCTCATCGTCCTTCTCACTGCCATCTCCAGCTCATCGCTCCATCGCTCAGCTCTCCTCAATATTTCACTTCATCCATCTCTTTTGTTTCTCTTTTCTTCAGCGTTTGTCTTTTGCATCTGTTTTAGATCACAGTCAGCGTGGCCCAGAGTCGCGTTCGCAGCCCGTCGCCCTCCTATAAGCCGAGATTTAAAAGCTATGCCTTCACTCAAGCCGCCTACGTCAAGACACCTGAACAGCAGAGGAAGTTCCTCATCGCACAGG[T/C]TTGTTTCTGTTGACTGCTCCACCATGTTGCCAAGCAGTGCAGCTGTGTCTATAACACAGCCTCTAATAGATATCAGCAGTGCCACACTTTTACTGCCTTGGCAGACTATAAAATTGACAAAAAGTGCCATAGGTTTGCAGAGGAAGGGACATGAGGGAGGGATTTTCCAGAGACTTGTTGTTGAGTCTGGAAGACATAGATATATACATACAGTAAAATGCAAATTTATAGGCCCCGCATGCAATGTACGTGTGCAGAAATCTGCAGATATTTGAGTATGTCATTCGGTCTATTTGTTTACTTATACTTTTATAAATATATATATTATAAATATATTTTATATATTTTAATATTTAAAGGAACCTTTTATCTTCCAAATGTACAATGCAAAGCAATAAATTCACAAATGATGTTAGAAGCAACTGCACAACAATGATAGTGATTCAAAAATATATGTTTTGGGGGGCCATATCTCATTATATTTTTGATGTCAGTTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12459
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 548 3633 13 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10184899)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10317237
GRCz11 1 11001348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGGTGGTGGTTRTAGATGAGAATAGYGGGGATGGCGCCACCGCAGCCT[T/A]GGAGGAAAAGCTGCAGGTACGTTTTATTTTTATTTTGTAATGTTAATAGA
Long Flanking Sequence:
AGAGGGAGGTGCGGGAACAGATGAATCTGCTCAACTCGCGCTGGGAACATCTGCGTGTGGCCAGTATGGAGCGACAGAGCAGGTGGTCACACGTTAGCATGACGCGCCTCTGTTTACCCACAAATATTGATCGCTCATATGCCTGATGTTGTGCTCAAACATTCCCAGGCTTCATGAAGTTTTGATGGACCTTCAGCACCAGCAGCTGAAGCAGCTCTCTGATTGGCTGGACACGACGGAGACTCGGATTAAAAGGATGGGAGCGCAGGCTTTGGGGCCTGAACTTGATGACATAAAGCGGCAAATCGAAGAGCAGAAAGTAAGTTCTGTCATTTTTTGGGTTGTTTATTAATGAGTAAACAAACTAATTAGGACATAATTGTTTGGTGTTTAAAAGCTCTTACAGGAAGATCTGGAGCTGGAACAAGTGCGAGTGAATTCGCTGACTCATATGGTGGTGGTTGTAGATGAGAATAGTGGGGATGGCGCCACCGCAGCCT[T/A]GGAGGAAAAGCTGCAGGTACGTTTTATTTTTATTTTGTAATGTTAATAGAAAAATCCACTTTTTTTGGAAATAGGGTGTTGACGGCTTGGTGGCTCAATGGTTAGCACTGTCGCCTCACAGCAAGATGGTCAATGATTTAAGTCCCAGTTGGGTCAGTTGACGTTTCTGTGTAAAGTTTCCATGTTTGCGCGGGTCACCTATAGTTAAACAAATGAGTTGTACTATTTTTGAATCCATTCAGCTTATCGTATTTTTTAGCAGGAGCTCTTTGTTCATTCTTACACTAGAATGAGAGGGTAGATTTTAGTCAAATTAACCTAGAAAATTTTCCAACCCTGGCTCATTGTGGATACATACCCAGATCTACATGTCTGAGGACAGTGAAAATATGTAACTGGAGGTACTGTCGCAGTTTTTTGATTTTGCAAATTTATCAGTGGCTACTGTGTATGCTTTTTGATCATCTCAAATTTCTCTTGCATACCCTCTTCTCTTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32609
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Essential Splice Site 553 3633 13 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10184881)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10317219
GRCz11 1 11001330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGAATAGTGGGGATGGCGCCACCGCAGCCTTGGAGGAAAAGCTGCAGG[T/A]ACGTTTTATTTTTATTTTGTAATGTTAATAGAAAAATCCACTTTTTTTGG
Long Flanking Sequence:
AGATGAATCTGCTCAACTCGCGCTGGGAACATCTGCGTGTGGCCAGTATGGAGCGACAGAGCAGGTGGTCACACGTTAGCATGACGCGCCTCTGTTTACCCACAAATATTGATCGCTCATATGCCTGATGTTGTGCTCAAACATTCCCAGGCTTCATGAAGTTTTGATGGACCTTCAGCACCAGCAGCTGAAGCAGCTCTCTGATTGGCTGGACACGACGGAGACTCGGATTAAAAGGATGGGAGCGCAGGCTTTGGGGCCTGAACTTGATGACATAAAGCGGCAAATCGAAGAGCAGAAAGTAAGTTCTGTCATTTTTTGGGTTGTTTATTAATGAGTAAACAAACTAATTAGGACATAATTGTTTGGTGTTTAAAAGCTCTTACAGGAAGATCTGGAGCTGGAACAAGTGCGAGTGAATTCGCTGACTCATATGGTGGTGGTTGTAGATGAGAATAGTGGGGATGGCGCCACCGCAGCCTTGGAGGAAAAGCTGCAGG[T/A]ACGTTTTATTTTTATTTTGTAATGTTAATAGAAAAATCCACTTTTTTTGGAAATAGGGTGTTGACGGCTTGGTGGCTCAATGGTTAGCACTGTCGCCTCACAGCAAGATGGTCAATGATTTAAGTCCCAGTTGGGTCAGTTGACGTTTCTGTGTAAAGTTTCCATGTTTGCGCGGGTCACCTATAGTTAAACAAATGAGTTGTACTATTTTTGAATCCATTCAGCTTATCGTATTTTTTAGCAGGAGCTCTTTGTTCATTCTTACACTAGAATGAGAGGGTAGATTTTAGTCAAATTAACCTAGAAAATTTTCCAACCCTGGCTCATTGTGGATACATACCCAGATCTACATGTCTGAGGACAGTGAAAATATGTAACTGGAGGTACTGTCGCAGTTTTTTGATTTTGCAAATTTATCAGTGGCTACTGTGTATGCTTTTTGATCATCTCAAATTTCTCTTGCATACCCTCTTCTCTTGTAAATCCACCAGAGGGCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 658 3633 16 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10177482)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10309820
GRCz11 1 10993931
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTCGTCCAGGATCTGCTGACTAACATCAAGAGCAAAGAGGCCGCTGGG[A/T]AGCTGGAAGCAAAGCTGGAGAGGTTTGCTCAGCGCTGGGACAAATTGGTG
Long Flanking Sequence:
AACTTTCATATATATATTTCTAATGATATATGATGTGATAAATTTGTATTTCAAAAAAATAAGTATTATTTTATATTTCTTTATTTTAAATATTTAGTAAGTATTTTTGGTACGTTAAGTGTGGTTATGATGACCATCCGACAAGCTAATTCAGCTGAAAATAATGTGAGATTTAAAATGTATTTAAATCTCATAATTAAATAGAAAATGAGGTGTATAATTGCATCTGCCAATTCTAAATGTATACAGTATTTTATTGTTTATACAGTAACTCCCAATGTTTTCTTACAATTTTCTTATAATTAAGACTTTTTCCTCACAATTCCTAGAAAAAGTGAGAATTGTCATATAAGTTGATGAATGACGCATAGGAGAACATAACAAATTTCTTTCCTCAGATTTTAAAAGCAGACCTGGAGCTGAAGAGGCAGACCATGGACAAGCTTTGCTCGCTCGTCCAGGATCTGCTGACTAACATCAAGAGCAAAGAGGCCGCTGGG[A/T]AGCTGGAAGCAAAGCTGGAGAGGTTTGCTCAGCGCTGGGACAAATTGGTGCAGGCGCTTCAGCTCACCAGCACCAAGGTGGTTATGCTAATGCCATTCCATTTACTGTGTCTCATCTCTTCCGCAATACTCTTCCATCTATTTCTATTTCGCTCGAAATTTGATACGGCTTTCCCTGCCATCGCTCCGAATAAATAAAGCGCTCTCACTATACATCTCGCCGCCTCTCTTTCATGTGCACTTCAGAAATCAGTACACTTCCGTACACTCGCACAATGCATGTCTTACTTTAACTTTCGTCCCCTCTTAGATTTCAACTATTGTCACCACATCCCAGTCGGAGATCACGCACACAACCATGGCAACTGTCACCAAGGTGACCACGAACCAGAAGAAGATGGTGAAGCATACTAAGGAGGGCATGTCCACCCCTCCACCTCAGAAAAAGAGACAGATTGTTGTGGATTCAGAACTGCGGAAAAGGTGAGCTTGTGTGTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39559
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Essential Splice Site 782 3633 18 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10171962)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10304300
GRCz11 1 10988411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCTCCCGTAAAGAAGGCAGTGTGGCAGATCTCTATGAAAAAGTGCTGG[T/A]AAGACCACATGAACACATTTTATAGTGATTCACCTGTATTACACAACAAA
Long Flanking Sequence:
CTCAAGAATTGTGTTGATTTAAGCTGATTTTAAATAAGTAGTTTGAACAAACAGGAAAAATCATTGTTTTTATGTTCTTGTGTCCACTGGAGTCCTCAGCACACATTCTCAAAGGAATTTATGTTGTGCGGAGGTTTTACATATATATTTTCAGTGTAAATCTGAGATACTGATCAGGACTGTGGTTTTCTGCAGAGAAGGCTTTTTCTTCCCATCTAAATAATCACTTTTGAGTTCAGAAAGGACGCTGAAACAAAGCCTGCAGTGATGGGGAAAATGCTAATCAATGCCTGAATCCCAACAACATTCAAAAGCCTAACAAACAACCAAGAATTACTAATTTGTTTTGCTGTTCTCTCATCGATGTCCCTGCAGATTTGATGTGGACTTCACTGAAATTCACAGTTTTATGACTCGGTCCGAGGCTGTTTTGCAAAATCCCGAGTTCTCAATCTCCCGTAAAGAAGGCAGTGTGGCAGATCTCTATGAAAAAGTGCTGG[T/A]AAGACCACATGAACACATTTTATAGTGATTCACCTGTATTACACAACAAATGAATGTAAAATAGAATGGATAACAGACTGTGAAGTATTTGTCGTATTTGTCGTATAAATTTGTATTGCAAAAATATTTTTCTTTAAATAATACTGCAATTTATATGAATCAATTTATTAGTAATTTAATCAGTAACATTTAACAAACAACAATATAAAGAAAAGAAAATCCGTCAAAAGAATCACAACCAAGTTTTCATTCAGCATTGAGCTAAACTTAACATTGCAGTCAAATCCATTTGCTTCGGAGTAAATAACAGATGACTGTGACCAAATTATTGCCTTTAGATATAGCTTAAACCAGTGGTTTTCAAACTGTGGTACGTGTACCACTAGTGGTACGGGGGCTTCCTTCTAGTGGTACACGGAGGAATGAAATATGTCATGTACATCCTACATATATTTCAAAATTTATTAAAAATGATGTATATATTATGCCATATATGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8798
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10142269)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10274607
GRCz11 1 10958718
KASP Assay ID:
2259-0261.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTT[T/A]GACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGAWGGAAAATGCAAGA
Long Flanking Sequence:
CCAAGTTTAAAGAAAAGAAAAATGAACACGTTGTACCGACAACAAAATGTCACAGAGCGTCCCCAGACATTTGTCGTGATAGCAGAAGACTGACACCTAGACGACAGAGATCTATTCATTTTCTAACAGGTGCACGGTTGCTTCTCACCTCGGTGTGATCCAGCCACTACATGCGTTTAATGAAATAAAGCGCCACTTTTTTTGACTTAGTTCAACAACAGTCAACAGCAGGGATTGTTATTCTGTTTTCTTGTTTTCTCTCTGTCCCGGTGCCAAGCGTAACTTAACAGGGGCTCGGGAGAATGCCCATGTTCGCTAACCTTGGAGGAAAGATTTGAATGCTCTCGTAATCTCCTCTCCTCTCTCTCCCACTCAGCGGGCTCAAGAGGAAGTCCATCAAAAGGAAACAAAGGTGAAGCTGCTGACGGATAAAGTCACCAATTTCATTTCAAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTT[T/A]GACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGATGGAAAATGCAAGACTTTAGAGGTGAGCTTGATATTGTGCCAGTGATGGGGTTGTGCTCGGGAGTCAGATAGTGTCTGGTTCACTGACATTTATTCATTTGCCAGATGCTTTCAACTTAAAGTCTTTTTAAAGTTTACATTTTATCTGTGCACGCGCATGTGTGTGTGTTCCCTGGGAATCCAACCCATGACTTTGATGTTGCTAGCGCCAGGCTCTTTTAGTTCAAGCCACTAACGCACTTCTAACCTTTTGATCAAATTCTCAGGACCTGGACCCGGCGTAATATGTTTGATTAACCACACGTGTCTCTCCATCTCTTTTGGCTCTTGTAGGAAGTGTGGGCATGCTGGTGTGAGCTGCTGTCTTATTTGGAGTTGGAGAATGCCTGGATGGACCTACTTGAAAAGAAACTTGATGAAACGGAAGGGCTTCAAGGAGGCATAGAGGAAATTGAAGAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18688
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1261 3633 27 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10142269)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10274607
GRCz11 1 10958718
KASP Assay ID:
2259-0261.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTT[T/A]GACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGATGGAAAATGCAAGA
Long Flanking Sequence:
CCAAGTTTAAAGAAAAGAAAAATGAACACGTTGTACCGACAACAAAATGTCACAGAGCGTCCCCAGACATTTGTCGTGATAGCAGAAGACTGACACCTAGACGACAGAGATCTATTCATTTTCTAACAGGTGCACGGTTGCTTCTCACCTCGGTGTGATCCAGCCACTACATGCGTTTAATGAAATAAAGCGCCACTTTTTTTGACTTAGTTCAACAACAGTCAACAGCAGGGATTGTTATTCTGTTTTCTTGTTTTCTCTCTGTCCCGGTGCCAAGCGTAACTTAACAGGGGCTCGGGAGAATGCCCATGTTCGCTAACCTTGGAGGAAAGATTTGAATGCTCTCGTAATCTCCTCTCCTCTCTCTCCCACTCAGCGGGCTCAAGAGGAAGTCCATCAAAAGGAAACAAAGGTGAAGCTGCTGACGGATAAAGTCACCAATTTCATTTCAAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTT[T/A]GACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGATGGAAAATGCAAGACTTTAGAGGTGAGCTTGATATTGTGCCAGTGATGGGGTTGTGCTCGGGAGTCAGATAGTGTCTGGTTCACTGACATTTATTCATTTGCCAGATGCTTTCAACTTAAAGTCTTTTTAAAGTTTACATTTTATCTGTGCACGCGCATGTGTGTGTGTTCCCTGGGAATCCAACCCATGACTTTGATGTTGCTAGCGCCAGGCTCTTTTAGTTCAAGCCACTAACGCACTTCTAACCTTTTGATCAAATTCTCAGGACCTGGACCCGGCGTAATATGTTTGATTAACCACACGTGTCTCTCCATCTCTTTTGGCTCTTGTAGGAAGTGTGGGCATGCTGGTGTGAGCTGCTGTCTTATTTGGAGTTGGAGAATGCCTGGATGGACCTACTTGAAAAGAAACTTGATGAAACGGAAGGGCTTCAAGGAGGCATAGAGGAAATTGAAGAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19441
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1295 3633 28 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10141856)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10274194
GRCz11 1 10958305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTAGGAAGTGTGGGCATGCTGGTGTGAGCTGCTGTCTTATTTGGAGT[T/A]GGAGAATGCCTGGATGGACCTACTTGAAAAGAAACTTGATGAAACGGAAG
Long Flanking Sequence:
TGAAGCTGCTGACGGATAAAGTCACCAATTTCATTTCAAAGGCTCCTCCCGCGGCCCATGATGCCCTGAAGGCAGAACTGGATGTTTTGACTTCTAACTACCAGCGCCTGTGCAGCCGACTCGATGGAAAATGCAAGACTTTAGAGGTGAGCTTGATATTGTGCCAGTGATGGGGTTGTGCTCGGGAGTCAGATAGTGTCTGGTTCACTGACATTTATTCATTTGCCAGATGCTTTCAACTTAAAGTCTTTTTAAAGTTTACATTTTATCTGTGCACGCGCATGTGTGTGTGTTCCCTGGGAATCCAACCCATGACTTTGATGTTGCTAGCGCCAGGCTCTTTTAGTTCAAGCCACTAACGCACTTCTAACCTTTTGATCAAATTCTCAGGACCTGGACCCGGCGTAATATGTTTGATTAACCACACGTGTCTCTCCATCTCTTTTGGCTCTTGTAGGAAGTGTGGGCATGCTGGTGTGAGCTGCTGTCTTATTTGGAGT[T/A]GGAGAATGCCTGGATGGACCTACTTGAAAAGAAACTTGATGAAACGGAAGGGCTTCAAGGAGGCATAGAGGAAATTGAAGAAGCTTTGACTGTGAGTGTGCCTCTTTATGCTGTTTTGGGGAACTTTTAATTTTGTATAAGCCAGGTCAGGGGCCTCATTTACGAAGACTTGCATGGAAATCATACTAAAACATTGCGTACGCACAAAGCTGTAAATGTGCGTATGCAGAAAAAAATGTATGATGTATGAAACACTGCGTACGCCGAAGCCCACGCATATTCTTTGTACATCCGAATGAACGTGAAACTGAGCGCAACATGCACAAGCGCAAAACCCCTCCCTGCCTCCTCCCCCGTTCGAATATGCTAAAGACTCTACTTTGGCAAAACCCAACGAAAAAGCAATGGCAAAAGCAAGCAAAAAGAGAAACTTTGAACCGAATGTGATTTGGAGGTGTTCCTTTCGGAGGTAGACCTGAGAAAAACGGTGTTATTTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1520 3633 32 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10134039)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10266377
GRCz11 1 10950488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGGGAGTGCTGAGTATTCGCAGTGTGGAGCAGGAAGTGGTGCAGTCA[C/T]AGCTTGAGCAGTGCATGGTGGGTAATGTAGAATGTTTAGATACATTTGAG
Long Flanking Sequence:
TTTTTGTTTTGTTTTTTACTCACTCAAATACAAATCAGTTAACTATTTATTTGTTACTTGATTGCATATCCATTTATTTTTTCAATCAGAACAATTGTAAGGATTTCAGTGACCCTCATATCATTGTGTCTTTTAACAGAAAATTCAGACTGAGTTGAACGGCCATGAGGTGACACTGGATGACATGAAGAAAAAGGCTATGGAGGTTGACGCCTCAGAGAAAGTGATTGGAGAGATCGATGCAACATTAGTAAGACTTAAAAATCATATCATATTTTCATAGTTTTTTTCTGCACAAAAAAGTGAAATAATGAAATGCCTGTAAACAAATGTGTCTGTTTAAGGATAAACTTTTGCAAGTAAAGGGCAAGTTCCGGCTTTTCCAAAAGCCAGCGAACTTTGACCAGCGGCTGAGGGAGTGTGAGCGAGTGCTGGAGGAGGTGAAAGTGAAGCTGGGAGTGCTGAGTATTCGCAGTGTGGAGCAGGAAGTGGTGCAGTCA[C/T]AGCTTGAGCAGTGCATGGTGGGTAATGTAGAATGTTTAGATACATTTGAGTGCAGTTGAAGTCAAAATGATTAGCCCTCCTTTGAATATTTTTTTCTTTCTTTTTCAAATAGTTTCCAAATTTGGGTTAACATGGCAAGGAATTTCTTTACAGTATTTCCGATAATATTTTTTTCTTGTGGAGAAAGTCTTATTTGTTTTATTTCGACTAGAATAAAAACAGTTTTCATTTTTTAAAAACCATTTTAAGTTCAATATTATTAGCCCTTTATTCAGTTTGTCTACTGTTATACAATAATTTGCCCAATTAACCTTGTTAAGCCTTTAAATGTCACTTTAAGCTAAAAACTAGTATCTTGAAAAATATCTAGTAAAATATCATGTACTGTCATCATGGCAGATAAAAGAAATCAGTTATTAGAAATGAGTTATTAAAACTATTACATTTAAAAATGTGTTAAAAAATCTTCTTTCTGCTATACAGAAACTGGGGAAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32608
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1571 3633 33 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10133316)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10265654
GRCz11 1 10949765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAACCCAAGGAGTTAGACGACAGGCTGACGGCCCTCAAACTCGCTTA[C/A]AATGATTTGGGTTCACAGGTATGAGAAAACAAGGCTTGAGTGTAAAACGT
Long Flanking Sequence:
TTTTCATTTTTTAAAAACCATTTTAAGTTCAATATTATTAGCCCTTTATTCAGTTTGTCTACTGTTATACAATAATTTGCCCAATTAACCTTGTTAAGCCTTTAAATGTCACTTTAAGCTAAAAACTAGTATCTTGAAAAATATCTAGTAAAATATCATGTACTGTCATCATGGCAGATAAAAGAAATCAGTTATTAGAAATGAGTTATTAAAACTATTACATTTAAAAATGTGTTAAAAAATCTTCTTTCTGCTATACAGAAACTGGGGAAAAATATACAAGGAGGCTAATAATTGAGGAGGGCTACTAATTCTATAATTGCAGTACCACAGTTTAATACATTCTCAATTTGCCTCGTGCAGAAATTTTATAAGAACCTGAGTGAGGTGAAGTCTGAGGTGGAGACGGTGATAAAGACGGGGAGGCAGATTGTGCAGAAGCAGCAGACGGAGCAACCCAAGGAGTTAGACGACAGGCTGACGGCCCTCAAACTCGCTTA[C/A]AATGATTTGGGTTCACAGGTATGAGAAAACAAGGCTTGAGTGTAAAACGTGCACCATAGTATCGGTTTTGTTCAGTTTCTCATTGTAAATTATTATTACTTTACTTTTTAGAGCAACACAAACTCCTTCAAAAACATGATGTTACACATTTACACATTTGTTAAACACCCTTGAAGGTGGTTAATTACATTTTAGTCAGGTGCACTTCTTATCTCAAGGACTCCCCACAAGTTACACAAAAATCAGTAACTTGTGGGGAAAATAAATAACACTACAATTCAAAACTTTGAGGGCAGGGTTTTTTTATTTATATATGTAAAAATAATACATGTTAGATGTAAAAAAATAACTTCAAATGACCTCCAAATTTCAAATGAAGCTGTTCTCTTAACTGTTTATAAAAGAATCCTGAAACTCTCCAAGGTTTCCTCATATTCATTTTATTTGAATAATTTACTAATTAAAATGAATGGTTAAATGATTGCATTTGATTGATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39558
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1646 3633 35 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10131890)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10264228
GRCz11 1 10948339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTTCCTACCCAGGCAGCGCAGGAGGACACTGAGCATCATAAGCCA[C/T]AGTTGAAACTGGTGAGGGAGTTGGCAGGGACCCTGAAGGGTTTACTTCAT
Long Flanking Sequence:
GAACAGTCTAACCGAATGGCTGGCTACTACTGATGGGGAACTGACGCGCCGCTCATCGGTGGAGGGTATGCCAAGTGATTTGGATGCGGAGTTGGCTTGGGCAAAGGTGAATAAATACTTAAATTTCAGCAGCTTTGTATGAGTCTAAACTATTTGCAAGTCATTAAAGTAATAGTCATCCCATAAAATTACAATTTTGTTATCATTCACTGATTGTAGTGCTCTTATAAGTTTCTTTTCTCCAACGTTCTGATATTCTTTTTAATATATGAAGTGGTGGGAATAACTATTAGAAAATCTTCTTTAGTGTTAAACAAAAAATTTAATAAAATAGGAAACCCATAAAGATTTGGAAATACTTGAGGGTGAGTTAATAGTGAGTAACTTTACATTTTTGGGTGAATTATCCACTTATCCAAGGATAAGCATGATTTTTTTTTAAACATGATTTTTGTTTTCCTACCCAGGCAGCGCAGGAGGACACTGAGCATCATAAGCCA[C/T]AGTTGAAACTGGTGAGGGAGTTGGCAGGGACCCTGAAGGGTTTACTTCATAGCCAAGAGAACCTGATTGATGACAAGGTCAGTTTGCTGAACTGCAACTGGATCGCAGTGACGTCACGGAGCGAACAGTGGCTCAAACTCCTGCTGGTGAGCAACAACCGCTTCGTAGCAACAGTCTGACCCTGCTCTGAGTCATTTCATTGTAGGCAAAATATTTCTTAAGCTAAATGTGCCCTACAAGGCTAAATTCATTTCCTTTCAATTTCACATCTCCATATTGTTCTTTTAAATCCAGATGGCCATTTCTGGAGGCGGCAATAATGTTATGAAACTTTAAAGCATATTTATCTCCTGCTCTTCTTTATTACCTTTTCTACTGCTCGCCGTTTCCACATCTCATCTTTTATCTTTCTGACTATGTTTTCTACCTTATTCCGCTTTGTAAATAGCTATAAATATCTTGGGGACAACATGTCAAGAGATGAGGCTTAGCCTTGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1776 3633 37 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10128445)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10260783
GRCz11 1 10944894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGAACACAGGGGAACATTGTAAAGCTCAAGTGAAACCAAAGCTTGAA[C/T]AGCTTAACCAACGTTTTGACATTGTTGCAAGAAGGATTTTAATGGGACAG
Long Flanking Sequence:
AACTCAATTATTCTAGGTCTTATACTGTAACTTCATTTTTGTAGATAGCACAACTTCAAATTTTTAGCTAATGCAACTCAATTTTTCTAGGTAATATACTGTAACTTAGTTTTTGTAGTTAGAAAAACTTAATTGTTGTAATTACTGCAACTTTTTTTCTAGTTACCGCAACTTAATTTTTCTAGTTCTTATAACTTTTTTTGTAGTTCTCATAACTTACTTTTTTGTTACTGCAATTTAATATTTTTTTTGAGTTTTTAATTGTCAAGTGTAATTGTATTTTTTTTTTTTTTGCAATACCTATGAATTAATCAGATTTATAGCATTTATTCTAAATGCATCATTCATAACTGATTTGTTGGTGTTTTCTGAATGTTCAGGGTTTGCGAATGGAGTTGGAGGAGATGAAGGGGAAAGTTGAAGCAGTGCAAGTTCTAGCAGAGGATCTTATAAAGAACACAGGGGAACATTGTAAAGCTCAAGTGAAACCAAAGCTTGAA[C/T]AGCTTAACCAACGTTTTGACATTGTTGCAAGAAGGATTTTAATGGGACAGGTAATGCTATGAAAAGGTGCATGCCTATACACTACCTGACAAAAGTCTTGTTGTCAATCCCAGTTGTAAGAGCAACGAATTATAACTTGACTTCTAGTTGATCATTTGAAAAAGTAGCAGAAGGTAGATTTTTCAGATGAATCAGATCAGATGAATCAGTACTGCAGAAGACCTATTGAAACCAGCATGGACCAAATATTCTCACTGAAAGTAGTCAAGTTTCGAGAAGAAAAAATCATGATTTGGGGTTACATTCAGTATGGACCAAGCTAGAGATCTGCAGAGTGGATGGCAACATCAACAACCTGAGGTAACAAGACATTTGTGCTGCCTATTACATTACAAACCACAGGAGAGGGCAAATTCTTCTGCAGGATAGCACTCCTTCTCATACTTCAGCCTCCACATCCAAGTTCCTGAAAGCTAAGAAGGTCAAGGCGCTCCAGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25536
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 1801 3633 38 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10126857)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10259195
GRCz11 1 10943306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATTTGATCATATTTTCTTCCAGGCCTCCTCCCAAGAGTTAGACGAGTA[C/A]CACAGACAGGCTAATATATGGCTCCAGGTGCTGGACGAGGAGATTAAATT
Long Flanking Sequence:
AAAAGTGTCATTTAAATGTAATTGAAAAAAATATCCCAACACTGAGTTTGTTTTTGTTTGACCCAATACTGGATTACAACAACTGAGCATTTTTGGTGTATATATGCACAGAATTCACATTATTTTTTTCATATAAGATAAGGATGTGGCCTATTATCCAAACTGATACTTCTTATCATATAATTTCAATGTGTTTTCATAGTTATAAACATACTGGTTAGTAGCAAAAGTATTTTTTTCTAGTTGTTTACATATCACCACCTTGGAATTGTAAGGGTTTATCTCCATTCTGAGCAGTTTTACGTATTTCAAACTAACAAGGACATATAAGAAAAGTGAATTTGAATCTGATTTCTCTCCCTCTGCTGAAGCTAAATTCGTTAGCGACATTGTCTTATTATGCCACTTAGAAAATAGATTTTTTTTCAATGAATATAATTGGATTTGAATGTATTTGATCATATTTTCTTCCAGGCCTCCTCCCAAGAGTTAGACGAGTA[C/A]CACAGACAGGCTAATATATGGCTCCAGGTGCTGGACGAGGAGATTAAATTAGGTGAAAGTCTAAAAGAGGAAGATTTCCTGGAGGATGCGGTAAGAAAATACTCTCAGCTGTTTCTTTGGCTAAAATTAATTTCAGTCATTGGAACCGCGCGGCCTGCGAAAGGCTCCGAGCTTTATCGTAAAGATCTCATGACAAGAAACGTAATGAGTTTCAGTGAGCGGGTCTGCTGCATGAGTAACAAATGCTGGCACAGAACGTCATTGCATTCCATATATCTATCAGATAGACGGATGGATGGTTGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGAATGGACGGACGGACGGATGGATGGCAAATAGATGTGTACTATAGATAGATGGACAGATCAACGTAAAAATGGATGTGTGGATGGATGGTAGATAGAAAGATCGATAGAAGTATGGATTGATAGATGTGGTTAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32607
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Essential Splice Site 1876 3633 39 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10124567)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10256905
GRCz11 1 10941016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTTCGAGAGAAACACAACCTTCTCCATGACAGATATGACACTCTAAAG[G/A]TAATTGCTGAGCTGGTGACACATGTCAAGTACATGCTTTATTGGAAAATA
Long Flanking Sequence:
TTGAAACAGTGTCAGTCCAGCTTTCAGAGTTTAAGTTTAGTTCAGTTTAGCTCAGTTCAGTGTGGTTTAATAATCACTTCTGAGAGTCCAAACACTGGAGAGCAAATCCATCAATGCACAGCTCTACAGGTCCCGAACCATGCAAGCCAGTGGCGACAGCGGCGAGGAAAAAACTTCACCAATTGACGAAAGTGAAGAATTAAAAAAAACCTTTAAAGAGAAACCAGGCTCAGTTGGGCATGACCATTTCTCCTATGGCCAAACGTCTTGTGCAGAGCTGCAGTCTAGACACCAGAGGCTGGAGAAGCTGGACGTCAGTGAGACTCGTCTTTGATCTTTTTTTTCCCCTGTGTGTTTATTTGCAGACTATAGACGAGGAGGCTCTAAATGAACTGTTCCTAAAAGGGGAGAATCTCCTCAAGAGAACTCCCGGTGGAGAGAAACGAGAGGCCGTTCGAGAGAAACACAACCTTCTCCATGACAGATATGACACTCTAAAG[G/A]TAATTGCTGAGCTGGTGACACATGTCAAGTACATGCTTTATTGGAAAATACAGCAAGTGCGATGCTTTTACAAGCTCTTGACATAGGCTCATAACATGTCAGTTTGAATGTGTGTTCAAGTGCAAACCAAGGACAACTGTGGCATACATGTACACTTGAAGTCAGAGTTATTAGCCCTCCTGAATGATAAGCCCCCCCTGTATATTTTTCCCCCAATTTTTGTTTAATGGAGAGGTTTTTTTCAACACATTTGTAAGCATTTAATAACTCATTTCTAATAACTGATTTATTTTATCTTTGCCATTATAACAGTACATAATATTTTACTTGATATTTTTCAAGATAATAGTATTCAGCTTAAAAATGACTTTTAAAGGCTTAACTAGGTCATGGTAATTAGGCAAGTCACTGAATATTGATGGTGTCCTCCGTTCTTCTAATAATATTGGCCTTAAAATTATTTAAAAAGAAATTAAAAGCTTCTTTTATTCTAGCTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32606
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 2438 3633 51 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10101632)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10233970
GRCz11 1 10918081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGATCACATGGTTCAGACCCAGAGAGTAATGGTGGGGGATCTGGAC[G/T]AGATCAACGAAATGACGGTCAAACTCAAGGTCAGATTTTGATAGCATTCA
Long Flanking Sequence:
GCAGAATATTATTGAATATGATCTCAGAAACACTGTGGCTATGAAATTAGATCACTCCGCACACTTTGCAGTCCGATCTACCATCACCATACTGTATAATGTGATAGATCCACTTCTATCAGTCTGTCGGCTTCATGGCGTACGGTTTTATTTAATGCCCTTCTCCTGGATTGATGTTTTCGCAGGGCCAGTATGACGGTCTGAGTGCAGATTGGACATCCATTCAAGTTCTCCTTAAAGACTGGAAAGACAAATGCCAGCTCGCAGGTATCAGATCAGGCCATTACAGCTACAATAATATGCCATGAAAATTCATGACCGTTGTGTGTCTGAGATTCTGAAGAGCATTTGTCACTTTTGCAGCTGTAACTTTGACTGGTAGTGCAGCAGGAGATGCGGCTCTCGACAAATTCAACAAATCCTGGACAGAGCTTGACGATTGGTTGGCGCTGCTGGATCACATGGTTCAGACCCAGAGAGTAATGGTGGGGGATCTGGAC[G/T]AGATCAACGAAATGACGGTCAAACTCAAGGTCAGATTTTGATAGCATTCATACAATAAAATACTTTTGATTGTCCTGCAGGGGCTGTATCTATCCATCTATCTGTCAATCTATCCATCTGTCTACTTTTACAAATCTTTTCTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCTTTCTTTCTTTCTTTTTTTGTCTTTCTTTCTTTATGTCTTTCTTTCTTTGTTCTTTCCATCTTTGTTTTCTAAAACATCCATCCATCCATCCATCCATCTTTGTTTTATTAAACATCCGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25535
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 None None 1096 None 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 2459 3633 52 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10099785)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10232123
GRCz11 1 10916234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGACTCTCTCTAACAGTCAGCACTGCAAGACATGGAGCAAAGATGCCCA[C/T]AGCTGAACAAACAAATCACTGCGGCTCAGAACCTGAAGAACAAAACCAAT
Long Flanking Sequence:
TGAGCATCAGATCAGCATAGTAGTGTGATTTACGAAAGATCGCATGGGTCAACCGGTAGTGTGCATGTGTGTTTCATATTTCTGAATCTTAGACAGAATTTCAGTATATTGATAAATATGATGTTTTCAAGGAATGTACTGTCAAAATAATCACATTTAAACATAGTTCAAATTAACATGAATGACTATTGAGAGAAGGTGGCGAATGCAATTGAAAAATTTCACTGGCTCAAATACTTGTGTGTACATCAAGTGGTATAGATGCGTGTACAATGCTTATATGAAGAGATTTGTATGTTTATGTTAATATGTTATAAATCAATAATGTATTGAATTAATAAATGAACTATATTAAAATATAAGTTATGAGACTTATTATAAGTGGACCAAATATATCTTGCGGACTTACTCATATGGTGGCACTCTTACTGCAGTAAAAAATTGTGTGTTGCGACTCTCTCTAACAGTCAGCACTGCAAGACATGGAGCAAAGATGCCCA[C/T]AGCTGAACAAACAAATCACTGCGGCTCAGAACCTGAAGAACAAAACCAATAACCCTGAGACACGGGCAACTATTACAGACCGCAGTAAGTCAGCTTTACCTCGTCCATATCCATATCCTCTCTCAGTGATACACTGCATTTGTGCAGCTATTGAGGTGTCAACATTTGTAACAGCTTGGTGAAACTGTGCCTGAAATAATACAGAGAGTAAACAATGCCTGTGGCCAGGGATTGTGTCTAACCAGACAGCTCAAGGTCATTGTATTATTGAAACAAAACACAGCTGAAAGCAAAATACACTACTTTCAACATGATGTAAAGCTTGGTGTACTGTCTGTCTGTCTGTCTGTCTGTCTGTCATTCTATATATTGTTTTATTATTCTATCATTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa239
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 96 1096 2 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 2584 3633 54 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10097715)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10230053
GRCz11 1 10914164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCAGATGAATGTCACTAATGAGCTGGCAAACAAACTACTGACTCTTTA[T/A]GCAGACGACGACACAAGCAAAGTGAAACAAATGACCGAGAGCATGAATCT
Long Flanking Sequence:
CGTTTCATCATTCCATCATTTCCATCCATCATCAACCCTATTTTCTCATTACCATAAAAATTATCACCCCGCAATTATCCATCAAATCAACTAAAGCGCTTTCCTTGAAATGTTCCATCTTCTTTTATTTACAGTTGAGAAGTTACAGGCACATTGGGAAGATTCTCATGCCAAGCTGACGGCCAGAGTTCTTACACTGCAGAACATGTATAAGGACTCCAGCGATTGGTTGGAGGCCAGAAAAAGGGTGGAGCCTCTCATTAAGAAAGCCAATGAAAAACTCGAGAGCTGGAAGAAAGTTTCGCACAGCGTTGAAGATTTAAAAGGCCAAAATGCAGATGTCAAGGTAATTACATTCACATGATCTGCAGATAAACACATGTAATTGCTTCAAATAAATTCTACCTTATCGGATTGCAGCAACTTTCTAAGGATCTACAGCAGTGGCAGACTCAGATGAATGTCACTAATGAGCTGGCAAACAAACTACTGACTCTTTA[T/A]GCAGACGACGACACAAGCAAAGTGAAACAAATGACCGAGAGCATGAATCTGGCTTGGGCCAACATCAAAAAGCGGTGAGCTTCTGGATAAATCTGTGATTTTCCAGCATCAGAAACAAGTGGGGTTGCATAAGTATTTGTGGCATTGTTGAGTCTGAAATATATTGCACTGCTGGCACAGTGATGGTGCAGAAAAGGCTATTTAAAATGCTTTTTAAGGTGCAATTGCTTTCAGGAGACTTATAGACCAATTATTAGTCCACCAATAGTGTGTTTAAAGGGTCACGAAACATCAAAACCCATTTTTTAAGATGTTGACAGTCATTTATATGTCTCACATTGCGACAAACACCATTAGGACAAATATATTTCACTAAAAAAGTTAAAAATTTGTTGTTTTTGTGTAATTTCGAGCAAATTCTTTCTTCCGGTTTGAAATGAAAATTTGAAGCTACGTCAAGACCGTGAGAACATTGTGTAAAATCCAGCTTGGAGATTGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7897
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 255 1096 5 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 2743 3633 57 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10087804)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10220142
GRCz11 1 10904253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCGTCCTCAGGCCCTATCTAGATGCCGGCGTTGATCAGTGGAAACACT[T/A]GCACATGTMCTTACAAGAGCTGCTCAACTGGCTGCAGCTGAAGAGGGAAG
Long Flanking Sequence:
TGTTTTACACAGAGATATTTTATACGTGATGTCTAATGGAGCAAGGTAATTTTCACAGTATACATTTGTCAGAATTATTAGCCCCCCCTTTGAATTTTATTTTACTTTAAATATTTCCCAAATGATGTTTAACAGAGCAAGGAAATTTTCACAGAATGTCTGATAATATTTTTCTCATGAAAAAAGTATTATTTAATTTTATTTAATTTTATTTTGATTTATTTTATTTTATTTTTGAACAAGTGAAGAGTGAGTAAATAATGACAGAATCAATTTGGGTGAACTTTCCCTTTAAGTACGTAAGCCTGGTTAGAAGTTTTTTATGTTAATGCATATTCAAATCATCAGCAATAGCACTTTCTATGTCAAAATCAACTTCAGCATGACATTACAGTGCTCTCTGGTGGACTGTGTGATTGAACATCTTCCAGTCTGACGTCTAACCATCATTACCGTCCTCAGGCCCTATCTAGATGCCGGCGTTGATCAGTGGAAACACT[T/A]GCACATGTCCTTACAAGAGCTGCTCAACTGGCTGCAGCTGAAGAGGGAAGAGCTGGAGAAGCAGAAGCCAGTAGGGGGCGACGTGCCGACCGTTCACCAACAACTCCTCACGCACAAGGTGAGCCCAGGACAAATCCAATTCAAGCCTCAATGAAAAGCGTGAAGGATGCGTCGCGATGTGATTTATACGTTTTGTCTTCTGCCGCACCCGAGTGTGATCGTTATCAGAGTTCTTGTTAAATATTTAAACAGATGGAGATGATATCTTGCGTGGGAGAGGTGCAAAGACTCCTGTCTCTTTGCATGGCTGTGCGGACCAATTAACATCTGCTGATGGCCATCATCTGTCAGGGGCCGCTGTAAACAGGATGCGCTTGTGGATTAGTTAGTGTAGAGGAGAAACCGTCACACTCCACAGGTGCATGAGTGAGTGTGTAGGAGCTGCAGAGAAAGTCTCAGCAGTTTTTTTTTTTTTGCATTCTGGTAATGAGTTGACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19439
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 289 1096 5 26
ENSDART00000009886 None None 594 None 17
ENSDART00000102903 Nonsense 2777 3633 57 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10087703)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10220041
GRCz11 1 10904152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGAAGCAGAAGCCAGTAGGGGGCGACGTGCCGACCGTTCACCAA[C/T]AACTCCTCACGCACAAGGTGAGCCCAGGACAAATCCAATTCAAGCCTCAA
Long Flanking Sequence:
TTACTTTAAATATTTCCCAAATGATGTTTAACAGAGCAAGGAAATTTTCACAGAATGTCTGATAATATTTTTCTCATGAAAAAAGTATTATTTAATTTTATTTAATTTTATTTTGATTTATTTTATTTTATTTTTGAACAAGTGAAGAGTGAGTAAATAATGACAGAATCAATTTGGGTGAACTTTCCCTTTAAGTACGTAAGCCTGGTTAGAAGTTTTTTATGTTAATGCATATTCAAATCATCAGCAATAGCACTTTCTATGTCAAAATCAACTTCAGCATGACATTACAGTGCTCTCTGGTGGACTGTGTGATTGAACATCTTCCAGTCTGACGTCTAACCATCATTACCGTCCTCAGGCCCTATCTAGATGCCGGCGTTGATCAGTGGAAACACTTGCACATGTCCTTACAAGAGCTGCTCAACTGGCTGCAGCTGAAGAGGGAAGAGCTGGAGAAGCAGAAGCCAGTAGGGGGCGACGTGCCGACCGTTCACCAA[C/T]AACTCCTCACGCACAAGGTGAGCCCAGGACAAATCCAATTCAAGCCTCAATGAAAAGCGTGAAGGATGCGTCGCGATGTGATTTATACGTTTTGTCTTCTGCCGCACCCGAGTGTGATCGTTATCAGAGTTCTTGTTAAATATTTAAACAGATGGAGATGATATCTTGCGTGGGAGAGGTGCAAAGACTCCTGTCTCTTTGCATGGCTGTGCGGACCAATTAACATCTGCTGATGGCCATCATCTGTCAGGGGCCGCTGTAAACAGGATGCGCTTGTGGATTAGTTAGTGTAGAGGAGAAACCGTCACACTCCACAGGTGCATGAGTGAGTGTGTAGGAGCTGCAGAGAAAGTCTCAGCAGTTTTTTTTTTTTTGCATTCTGGTAATGAGTTGACATCGGCGTGATGGGTTGGAGCAAATGTTGGCGAAAATATCCAAACTAGAAATGAAATGATGAGTAGCCATTGCCTTCTATAGTATTTTTGTTTCCTATGGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13095
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Essential Splice Site 564 1096 None 26
ENSDART00000009886 Essential Splice Site 53 594 None 17
ENSDART00000102903 Essential Splice Site 3052 3633 None 78
ENSDART00000126518 Essential Splice Site 53 362 None 11
ENSDART00000141052 None None 206 None 6
ENSDART00000148305 None None 149 None 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10059093)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10191431
GRCz11 1 10875542
KASP Assay ID:
2259-0251.1 (used for ordering genotyping assays)
KASP Sequence:
GCATACAGGACGGCAATGAAGCTCAGACGAATGCAGAAAGCCCTCTGTTG[T/A]AAGWCCACACCACTTACGTTTTATTGTTGGYTTTCTAAACGGCTAAAATA
Long Flanking Sequence:
CTTGTCAAAAGTGACTATAAAACTGTGATTTATATAAATCACATTTTCATATAAAATCACAATTTGAAGTACATTGACATGCATACGAATAATGCATGCCATTTGCTAGCCTCATTGTCTAGACCTGCTGTGAAGATGTTATACAGTTCACGTTTTAATCTCTGTTGTGGTGTAATTGCCCTTAAGTAAAATGTCAGATTTTTAGATGAAACCATTTTGATCAATGGAGTAATAATGGAGAAACTAATTGGATGAAACTAGCTGGATGTTTCTCCCCTGTTTTTCAGATCCTAACAAATAAGATCCAAATAAAAAAAAATTGTCAGATGCAGAGATGAGAGGTTTTACTGTGTGACAGAAATCAAATGTTGCATGATCAGCATACTAACATAAACGTTTGTCACATTTTCTCTCGCTAAAACAGCGGATCTCAACAACGTGCGGTTCTCGGCATACAGGACGGCAATGAAGCTCAGACGAATGCAGAAAGCCCTCTGTTG[T/A]AAGTCCACACCACTTACGTTTTATTGTTGGCTTTCTAAACGGCTAAAATACAGCTAAAGCTAAAACATTTGGTAATGCTTTATAAGAACCACACACTATGAATCATTTACTAAGCATTAGCAAATAGCTAATTTAATGTTTGTTAAGCATTAACTATATTACAAGACATCCATCATTAACAAAATATGAAAGTACAATCATTATACATGTGCCAAGTCAAGAATACAGCATTTGTAGCTGTAGTTATAAACTACTTGCTAACATCTATTAATGCTTAACAAATAATACATTAACCATTTGCTAATGCTTAATAAATGATTTATAATGTGTAGTTATTATAAAGTTAACAAATATTTCTACTTTTGTCTAAAAGCAAGTAAGAGAAACTACTTGTAAAAAGGAAGGAGTTAGCAGTTAGCTTTCTATTAGCTGTTAGCATTCTCTGTCAGATTGTATTCTCTGTCAGAAATAATGATGATTATAAAAAGCTGTTTGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007013 Nonsense 998 1096 22 26
ENSDART00000009886 Nonsense 496 594 13 17
ENSDART00000102903 Nonsense 3508 3633 75 78
ENSDART00000126518 None None 362 None 11
ENSDART00000141052 Nonsense 106 206 2 6
ENSDART00000148305 Nonsense 51 149 1 4

The following transcripts of ENSDARG00000008487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 10024750)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10157088
GRCz11 1 10841199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAGCCAAACTACTGCGGCAACACAAGGGACGATTGGAGGCAAGAATG[C/T]AAATCCTGGAGGATCACAACAAGCAGCTGGAATCGCAGCTTACACGCCTA
Long Flanking Sequence:
ATGCAGCGCACTGTAGTTAATGTAGACTGATATTACGAGCGATAATAGTGTTCATGCAGCACACTGTATATTGTATACATGGAGATTATGAGCAATAATAACTTATTCGTGTAGTATGGCACAGCTTGTATAATTGGAGATTACGAGCGTTAATAACCCGTTCATGCAACATGCCATAGTTTGTGTAGAAGGAGATTACGAGTGTTAATAAAGCATTCGTCCAGTGCACCATAGTTTGCACGGAGATTGAGAGCAATAATACAATAATACCACTTAATAAATGAAGCCTGTTTTCCACTCGTGAAAATTTCTAATGTGTTTACAGGAAGCTGCAAGCGGAGTACGATCGTCTGAAAAAGGCACACGATCACAAGGGTCTGTCACCGTTGCCTTCACCTCCACAGATGCTTCCGGTGTCGCCTCAAAGTCCACGCGACGCAGAACTAATCGCAGAAGCCAAACTACTGCGGCAACACAAGGGACGATTGGAGGCAAGAATG[C/T]AAATCCTGGAGGATCACAACAAGCAGCTGGAATCGCAGCTTACACGCCTAAGACAGTTACTCGAGCAGGTGGGTGGCGCATATCCTTAAGATTTTAATCGTGTTTATGCTCTCTGGCAATGAATAACTACTTTTGGAAGCGACTGGAAAGGATTGAGAGTAAATGTCCATGGATTGCGCACCAAGGCATCTTTTAGCGGCGGAATGTGACACTTTTTACGTGCTTCCTTTTAACTGTTGATAGAAGAGATGAAATATTTGAAATGATATATTTTTATGTCAATATTTGCCTTTCAATGTTTGTCATATTTGTAGTTATATATAAATCCTTAACAATGGTTGCAGTTTTATGAATATTTTTCAGTATATCTTAATTAAGTTTATACTGTGTGTTCTGGCATTACTTTGTCTATGATCTGTAAAAGACACATGTAATGTTTTTTTGGAAATTGTCCAAAATGAGGTGTTAAGAGAGGTTTTTTTTTTTCTGGGTGTGTGTGT
Associated Phenotype:
Not determined