Busch Lab

ZMP

anapc5

Ensembl ID:
ENSDARG00000008461
ZFIN ID:
ZDB-GENE-030131-1574
Description:
anaphase-promoting complex subunit 5 [Source:RefSeq peptide;Acc:NP_955916]
Human Orthologue:
ANAPC5
Human Description:
anaphase promoting complex subunit 5 [Source:HGNC Symbol;Acc:15713]
Mouse Orthologues:
Anapc5, Gm10482
Mouse Descriptions:
anaphase-promoting complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1929722]
predicted gene 10482 Gene [Source:MGI Symbol;Acc:MGI:3644444]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16935 Nonsense Available for shipment Available now
sa34461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16935
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 147 760 5 18
Genomic Location (Zv9):
Chromosome 8 (position 42152958)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40167731
GRCz11 8 40201505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCGTCAGATGCTGCTTGCCTRCAAWAAACTGTCCTTCAGTCAGGTGTA[T/A]AAGYTGTAYAAGTCTCTGCAGCAGTTCWGCCATCGTGGAAATCAGCCTGA
Long Flanking Sequence:
GGAAGCATCTGTGAGGTAATATGTGAGGTAAAATTTTTAAAGAGCATTTTCAAAGGGATAGTTGACCTCTTACTCTTCACTCAAACAGTTTTAAAGTAATAAAAACAAACATCCACACAAATCAAGCAGTTTAATCCATGTCTTTTGAAGAGAATCAATCATCTTATAGTAAAAAAAATTATATTCACATTTACAGATTTATCAGGCAATCTAATTACCTCCATATTAGTTTGCTCTGCAAGAAAAAAAAAATGATTGATTTATACAGAAACTCAAAATGCGTGTTGTAAAATTCATGAACACGATTAGTTTTCACATGTCAAGCAAGCATTATCGAGCTTCTCTGACCACATATGACAAATGTTAGCTAATAAATGTTCAGTGGTCAGGGTGTTTGATCATTGTTTTGTAAAGCCTTCCTTGTGAATCTTTCCATCATCAGGTCTGTTCATGCGTCAGATGCTGCTTGCCTACAATAAACTGTCCTTCAGTCAGGTGTA[T/A]AAGCTGTACAAGTCTCTGCAGCAGTTCTGCCATCGTGGAAATCAGCCTGAATTGTCTGCTTTACCTGCCGAAGACATGGAGCTGACGAGTAACGAAGACCCTAGTGCTGACCACATAGACAAAGATGAGCTGGACACGCCGTCTCTACACCAGTCTGAACTGAGGTTAGAGATGCCAACTCATTTATCAATGGAGTCCAGGCTATATTAAAGGGGAAGTTTGCCCAATAATAAATATTTTGTTGTTAATTTACTCATCAAGACATTAAAAGTAGTTGAAATTGAGGTACTTATGTGGTCAATATCTATGAAACTTAGATTTAGTGAATCAGTGAAATGTCAATTTTGTTTTGTCTCCTTTATTATTATTATTTTGACTCTATGAATCACCTAGAACATTTTAATATTTTATGTTCAATTAAAGAAGAAAAAACAAGTCACCTACATCTTGCAAGGCCTGAAGTTGCTTAATATAACAGCAAATGTTTATTTTTGGGTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5499
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 465 760 12 18
Genomic Location (Zv9):
Chromosome 8 (position 42147669)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40162442
GRCz11 8 40196216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTCTTGTTGAATATGAACAGTCTGGAGCCGGTTAACYTCAGTGTRCAG[C/T]AGAACAACACTGAGGCCTTTGCTGTTGCTCTCTGCCATCTAGCAGAACTT
Long Flanking Sequence:
TGCAGTATTTGGCGTCTCTGGGCATTCAATCATTGGTCCAGCAGGGAGCAAAACAGGGAATGCCAGCAAACAAGCTGCTGGACGCCCTGCGAGGAACCGACATCATGCACTGGAAGCAAAGCCTCTCCGAGCTGATAGAAATCAGCCTGGCGCAAACCACATCCATATGGAGGATGTATGGCAAAAGGTCAGATTACACACACTCTGTAAACCTTCAATTAATTAGATGTTTACAAAAATTATTAAATTAAATATTAGCATTGTGAAATGATATTTCTTACTGTTTTACATATTCTGTCATATATAATGACTTTTAATTGAATACACGGGTTCGCTCCTTCCCTTCACACTGAAATTAGCAACACAGCTAAAACAATTTTTCATGAGGATTTTGCTGATTTTGATTTATTTATTTGTTTGTTTGTAGCACTATGGCACAGCAGCAGGCTCAGCTCTTGTTGAATATGAACAGTCTGGAGCCGGTTAACTTCAGTGTACAG[C/T]AGAACAACACTGAGGCCTTTGCTGTTGCTCTCTGCCATCTAGCAGAACTTCACGCTGAGCAGGTACACAACCAGTGCAATGCATGAACTGCTTAAATTTCATATCTCCTTTTGTTAAATCATACATAAGCTGTGTGTCCACCGAAGTGTTTTTGCGCTGCTGAAATTCCCAATAGTATTTGGATGCAGACTTGGATTTGCAAGCTGAGACTGCATATCTCAGGCTTGCAATGTCAGACACGATGCACTCAATGGAGCTAGTGACGCACTGTAAGGTGTAGAGTTAAAGGGTTGCCATTAAAATGCATTGCATGCAGCTCACCTTGCAAATGCATCAAGTCTGCATCTAGATCCCTCTCGAAATTCCAGCTAAGTTTTTTTTTTCTTTTTCTTGTTGTCAATAGAAGTGCCACATTTTTTAAAGATGAGGTTGCATTATGAGGCACTGAGTATGCATTGACATTGCTCTCTGCCAGTTGAAAAACCACTCACATCTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026592 Nonsense 737 760 18 18
Genomic Location (Zv9):
Chromosome 8 (position 42138151)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40152924
GRCz11 8 40186698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTACAAGCTCGCCTGCATCAGACTCTCGGCAACATCTCTCAACGCAAC[A/T]GATGTGCCATGCTCTTCCGCCTGCTGGATCAGGAGCTGCCATCATCCCGG
Long Flanking Sequence:
TTATCTTCCCATGCCTAATCTCTTTACAGCCATTTACCGGTAATTTTCCAGAAAAGAATGTACATTATGTGTGACAAGGACTAATGAGTATAAAAACAAATGTGATCTGTCTTCATAGCTGATGTTGGGGATCTCCGAGCAGGCTCTTGGTCTGGTGCAGGATGTGCTGGAGTCAGTTTTGGCTCACGGCTCTTTGATGGACAAAGGCAGAGCTCTTCTGCTGGCCGCTCGCTGTCAGATGGCTTCAGCAGGAGCTGCTGCACAGGAACACAGACTATCTGGTACTGCCTCCTGTTTGGAGCACATCTCACTCTGTTAATTTCACACTTCATGTGTTTAAGTGATCTTTTTTTTCTCCTGCAGCTGTGGAATTAGCCGTGCACACACTTGATGAGGCAGCGGTGTATTTCTCTCGCCTTGACTGTAAAGAGCGCATGAGAGACATTTATTATCTACAAGCTCGCCTGCATCAGACTCTCGGCAACATCTCTCAACGCAAC[A/T]GATGTGCCATGCTCTTCCGCCTGCTGGATCAGGAGCTGCCATCATCCCGGATGACTGTGGTCAATCGACTTTAGAAAACATCAGCTGCTGCTTTTAATAAATGACAACAGAAAACTTTGTGTCCAGTACTTTGTGGACGCTCAAAATAAATGTCATTTTCTCTGTGATAAACTAATCTGTGACCCTTTTTTTGTTTGTGTTTTGTCTAAGTGTATTCATGTGCCATAATTGACCTGTTAGAATTTTGTGCTGGTTTATATGTATCCAGCTACTTCTTTACACATTCCTGCCTAGAGTGAAACTATCTACTCCACCCTTTTACCCACATCTTTTTGTAAACAGATAGCAAAGCAGCTAACAATGATGTTCTTCCTTTCTTTGCACAGTGAACCACACATGAATGAATTATTATTATACCAGATATTCTGTTTCATCTTTTAAGATGTTGATTTAAAGGTTTTAATATATTTGCAGATTTTCAATTATATTTATTAGTAATT
Associated Phenotype:
Not determined