Busch Lab

ZMP

si:dkey-85k8.5

Ensembl ID:
ENSDARG00000008414
ZFIN ID:
ZDB-GENE-060526-343
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LYD4]
Human Orthologue:
EXOC3L2
Human Description:
exocyst complex component 3-like 2 [Source:HGNC Symbol;Acc:30162]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20478 Essential Splice Site Available for shipment Available now
sa45213 Nonsense Mutation detected in F1 DNA Not yet available
sa1012 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20478
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017138 Essential Splice Site 35 354 2 7
Genomic Location (Zv9):
Chromosome 5 (position 38353797)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36153481
GRCz11 5 36753634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCATCTCTCTTTAAATGTAAAATAATGAACTGTTTGTATGGTGTTTA[G/A]CTTCCAGAGAAAAATCGAGATGTTCCACAACACACAATCAGAGTTTGGGG
Long Flanking Sequence:
CTTGTTTCTTTGGTCTAACTCAGTGTTTCTCAACCATGTTCCTGGAGGATCACCAACATTGCATGTTTTTGATGTCTCCCTTTCTGTCACGCCCATTACAGGTCTTTCAGTCTCTGCCTATGAGCTGATGATCTGAATCAGGTGTGTTTGGTTAAGGAGACATGGAAAATGTGCAGAGCTGGTGTTCCTACAGAAACGTGGTTGAGAAAAACTGATATAACATTTTTAGACATTTAATTTACGAGTTCCTAAAATAAGTTTATGTTAGGATGCATTACTCTATATCTAAGTCTCTATTCAAAGTCTGATTCAAAAGCAAGCTGTAAACATGTCTTAATCACTGGAGGGACTAATATGTTTGACACAGAAAAACTAAACAAGTTCTAATCATTCTAATAAATGTGTGGCACTTTTTTACACTGTTCCCTCTATTTTATTTAGCAAGTGTCTTTTTCATCTCTCTTTAAATGTAAAATAATGAACTGTTTGTATGGTGTTTA[G/A]CTTCCAGAGAAAAATCGAGATGTTCCACAACACACAATCAGAGTTTGGGGATCATGGAGATGGTTACATCTCCAGGACCATTGCTCTTGTCAACTGTGTTCCACCATTCAGGTTTGTTTTGTTTTCTTATTCACCCTACATATCTATTCAACTTCTCTCATCCTTAAGTAAACTCAAAGGTCTAGTTAAATCAAAATAACGTTTTTTAGATGTTAGTATCAGTATGTAAGTCTTCAATGATATCTAAAAGCTAGAAATAATAATAATAAATGCCGCCTTTATGGACACCCAAGGTTGCCTTACAACAAGCATCAACAGCAATAACAGAACAAATTAAAACAATTAATAAAACGTTGCCAAACAAGATTTTAAATGCATGTAAAGAGTTGCAGGTACAAACACATCATGAGCATAAAATAACATGATAAAAATATTCAAAAGAAAGCCTGCTTAAAAAGATGGGTCCTGAGATGAGATTTAAAAGTGTGAAGACTATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45213
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017138 Nonsense 76 354 3 7
Genomic Location (Zv9):
Chromosome 5 (position 38355597)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36155281
GRCz11 5 36755434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATAGCATCGAAATAATATCTTATCTGGAATCCTGTGCAGGAATTTCGTG[G/T]AGCGCTGTCGTCTGTGTGACACTGTTGGCAGTGAGGACATGTCCCAGCGA
Long Flanking Sequence:
CATTTAAAGTCTAGTAACCCTAAACTCAAAGTAACAGTTTGGTTATGAGATATAATTGACATGGATGATCCAATGATCCAATGTTATATATAGTTAGCAGAATGTCTATACTAAATTATTTCACTTATCAGTTTTATTCTTCTGAGAAATACACTGTAGACTACAAACTGGTAATTTCTACCAGGACAGTATTCTGTTATGTGAAGAGGCATTTCCTTCAGCCACAAAACACAATACACTGCAATGAATAATTAAACTAAAGGTAAAACATCTGACATTTTAGATGTTCATCCTTTTTAAAGAATGAGACCGTTTATAATAATGTGTATTTTTAAATAAAAAAAAAGTTAAAATATTAGTTTGTATTCTATTCAGGACAATAACGTCTTTAAAAAGCTAATGAAATCAATATACAAACAATAAAAGCTGTTTAAAACAACAACACAATTGAATAGCATCGAAATAATATCTTATCTGGAATCCTGTGCAGGAATTTCGTG[G/T]AGCGCTGTCGTCTGTGTGACACTGTTGGCAGTGAGGACATGTCCCAGCGAGCTCAGTCCTCTCTGGAGCGCATTGTTAGCCAGTCGGTGCGAGTTCTTTCAGACATACTGTTTGAAAACATCAGGGTGAGACGCACATGCACACGTTCGCATCTGGCACAGATATAATATATCCCTAATGCATTCGTTAACGATTTTCTGGCATGATTTCAGCCATTCTTCGATAAGCTGGTGAAAAGGAAGTGGCTGGATAACAATGAGGCCTATGAGAGTATTGAGATGACCATTAAACAGCACTTTAAGAAGTTCCGCAGGATGGACTGCCCTCCATATCAGGTATTATTTACACACACAAACCCACTCACACAAACATTCTCTTCGGTCGGTTGGTTGGTTGTTTGACTGATCATCTCATTGACCGACAGGCATTGGTGAATGAGGTGCACAGGCAGGTCCTGGTTGAATATGTTCGTGCCATCATGAGGGGGCGGGTCATCTGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5309
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017138 Essential Splice Site 251 354 6 7
Genomic Location (Zv9):
Chromosome 5 (position 38356777)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36156461
GRCz11 5 36756614
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTATTCAGATGGAGGTTGGGGTTTTGGTGAAGGAGTTTCCAGATATACG[G/A]TAAGAYCACCTTTTTCTAGACCATTGTCATTGATATGTGATAAAACTGAT
Long Flanking Sequence:
TAATCAAAAAACAAATAAAAAGTGCTTCAAGGTAATTCATGTATTGGTGCTCTTTGAGTAAGGGACTTCTTAGGGAAGTATGAAAAGGCATGGAGAGAGGGATCTGGATGCAGACCTGGTGCAGTGCAATCTGAGCTGCATCCAATGCTTTTGAATGCGCTCACCTAACCCCACCCCTAACCCTACCCGTCACAGTGGCATCATGCACATTGAGTGCATTGTGTCTGACATTGCATCGCTGAGTGATGCAATCTCAGCTTGCATCATAAAGGCTGCATCCTGATACTATTGAGGCATTGACCACTTTTTTCACTTAAAAGTGCCTTGAACTATATATATATGATCTTCTCATCTTTTCTTTTTCTTTTCTTTTGTCAGGAATCAACTTCCTTCTGGTTGGACAGTGTGATTGTTCACCTCGCTGACATCATTGTGTTGGAGGACACTCCCTCTATTCAGATGGAGGTTGGGGTTTTGGTGAAGGAGTTTCCAGATATACG[G/A]TAAGACCACCTTTTTCTAGACCATTGTCATTGATATGTGATAAAACTGATGGAGTTTAACCACTAGTAAGGTGTGCATTTTAGAACCTTAATAATATGCATGCTATTTCTTTAAAACACCACTAGTTGGATTTGTGCTTAGCAGTGTTTGCAAGAAATGGCAGGTATACTATTTTGGCTCACCCACTACTAATCTCTAGGTCCAATTGGGGATTTACATTGTCTCACTGCTTAAAGAAATCCAATCAAAATGGTCCAACTTTCACAAACCAGCTTCCCGCTCCAGAAAGAAGCCACTATCTACACCTCCATTCTATAACGCCATTTCTAAAATGTGCATACAGAGACAAGCACAGCACACTCTTTCTTACTCTTCAGACTACAGTAGGTCACACTAGACGTTGGACACACTGTATGTCTATGGATGCTGCAATTGTCATAATAGGATGTTATTGTCCAGCTCATGAGACCAAAATGTGTGATTAATAACAATATTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1012
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017138 Nonsense 253 354 7 7
Genomic Location (Zv9):
Chromosome 5 (position 38362269)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36161953
GRCz11 5 36762106
KASP Assay ID:
554-0916.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAATGTGAAATATGAGTGATTACGCCCTCTCTCTTTGCTCACAGGAGG[A/T]GACACATCTCTGCGGTKTTGAATGTGCGAGGGATGGTGCATCAGACGGAC
Long Flanking Sequence:
TAATGGTTATGCACAAATATATTACTGTAAAACATGCTACAGAAAATATTCATTTAAAAGAGAGACCTGTTAGGGGTATACACATTTGTGCTGAGCACTGTAGCTACTGTATGTTTGTTTGACTACATTTTAAATTGATTATTGGTGACCCTTCAAACCTAAATTACATTACATTAAGATTACCTTTGTAAACATCTAATACTCCACGAAAGTTAATATTTATAATAATTAATAACACCCATATATGTAAAATCTCAACATAAATATTAATTTGTTTTATATGATAGATTTTGAAGTTATATTTATTGCTGCTTTTTCTTTTATTCATTGTGAACTAATGCTTATTTATGTTGACACTTTATTTTAACTATATTCAAATATTTTTCAACCTTGGACAATGTATCTCTCTAGTTAAGTGCAAATGTACTAGGAATAATGAAATATTAATATCTGAATGTGAAATATGAGTGATTACGCCCTCTCTCTTTGCTCACAGGAGG[A/T]GACACATCTCTGCGGTTTTGAATGTGCGAGGGATGGTGCATCAGACGGACCGTCAGGAGATTCTAGCTGTCGTCCGGGACTTAGAGAACAGTGACAGCTCCATCAATCTGCCCCGTGAACGTGCCCTGTTTTCTGAGATTGCAGTGGCCAAAGACATGTCCTGTCTGGGGCTGGTTTTGATCCGCTTCGGTTTGACTGTGTCTTCATGGGTCGCCAGCGCCCGACCGCACCGTAACCACAGCAGGAGGAGCTGGAATGAGAAACACAAAGAGGGCAGACCACAATCGAAACGCTTCGCTGAGAATTAAGATACAGCGTAATTACAACACATTAGCAACCCATAAATACACAGCATTATAATCAAAGCAAATCAGTATAACATTAAGCAAAATGTCTTTAGACTAGTTTTAGGCTAGATTAAGTGTGGATGGAACTAGGGCTGAACGATTTTACAAAAAAAATTATCTAATTGCACTTTATTTTACCAATATTCTGATTGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461