Busch Lab

ZMP

fam114a1

Ensembl ID:
ENSDARG00000008287
ZFIN ID:
ZDB-GENE-070410-52
Description:
family with sequence similarity 114, member A1 [Source:RefSeq peptide;Acc:NP_001082947]
Human Orthologue:
FAM114A1
Human Description:
family with sequence similarity 114, member A1 [Source:HGNC Symbol;Acc:25087]
Mouse Orthologue:
Fam114a1
Mouse Description:
family with sequence similarity 114, member A1 Gene [Source:MGI Symbol;Acc:MGI:1915553]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24838 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39588 Nonsense Mutation detected in F1 DNA Not yet available
sa11826 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24838
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Essential Splice Site 188 546 5 13
ENSDART00000147228 None None 254 None 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17328276)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17893444
GRCz11 1 18586381
KASP Assay ID:
554-7812.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACCATCATATTTATGTTCATACTAATTCATCCTTCTTGCTTTTTTTA[G/A]GGAAAGTCAGTAATAACTGGAGGTCTTGATGCTTTGGAGTTCATTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39588
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Nonsense 330 546 8 13
ENSDART00000147228 Nonsense 97 254 3 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17323341)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17888509
GRCz11 1 18581446
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTTGGGCATAAAATTCATGTTATCTGTGTGTTTCAGCTGCTGATGGA[G/T]AGGAGTTTGTCAGTGTTCTTACCGAACTACTCTTTGAGCTCCACGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11826
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082063 Essential Splice Site 354 546 8 13
ENSDART00000147228 Essential Splice Site 121 254 3 6

The following transcripts of ENSDARG00000008287 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17323266)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17888434
GRCz11 1 18581371
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTACTCTTTGAGCTCCAYGTTGCCGCAACTCCAGACAAGCTGAACAAA[G/A]TATGGTCACACTTTYAAACACATTCATGTATATCCACTGTYAATGCAAAT
Associated Phenotype:
Not determined