Busch Lab

ZMP

si:ch211-105n9.1

Ensembl ID:
ENSDARG00000008249
ZFIN ID:
ZDB-GENE-041001-178
Description:
Patched domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RIV7]
Human Orthologue:
C6orf138
Human Description:
chromosome 6 open reading frame 138 [Source:HGNC Symbol;Acc:21345]
Mouse Orthologue:
3110082D06Rik
Mouse Description:
RIKEN cDNA 3110082D06 gene Gene [Source:MGI Symbol;Acc:MGI:1920485]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15542 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022572 Nonsense 522 916 3 3
ENSDART00000146055 Nonsense 503 897 3 3
Genomic Location (Zv9):
Chromosome 20 (position 36093915)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36166428
GRCz11 20 36069307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCAGCACTTCCTAAGGGAGCATTACACAGAATGGATAACCAACACCWA[C/A]GTCAAGCCTTTYGTGGTGATSCTCTACCTGATTTATGCCTCRTTTTCRTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1394
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022572 Nonsense 713 916 3 3
ENSDART00000146055 Nonsense 694 897 3 3
Genomic Location (Zv9):
Chromosome 20 (position 36093342)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36165855
GRCz11 20 36068734
KASP Assay ID:
554-1306.1 (used for ordering genotyping assays)
KASP Sequence:
AGCATCAAGTTCATCGTTTTCAACCCAACGTTTGTGTTCATGGACCGCTA[C/A]AGTTCCTCCATCATCTCTCCAATCCTGACGTCAGGTTTCAGCGTGCTCAC
Associated Phenotype:
Not determined