Busch Lab

ZMP

si:dkey-217k21.3

Ensembl ID:
ENSDARG00000008235
ZFIN ID:
ZDB-GENE-041210-47
Description:
conserved oligomeric Golgi complex subunit 5 [Source:RefSeq peptide;Acc:NP_001038609]
Human Orthologue:
COG5
Human Description:
component of oligomeric golgi complex 5 [Source:HGNC Symbol;Acc:14857]
Mouse Orthologue:
Cog5
Mouse Description:
component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8385 Nonsense Mutation detected in F1 DNA Not yet available
sa20180 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8385
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021953 Nonsense 223 810 8 22
Genomic Location (Zv9):
Chromosome 4 (position 2459290)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2658169
GRCz11 4 2588280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGAATCCATCTCAGGTGGGGACAGCCCTACAAGTGTTTTACAACCTT[G/T]GAAATCTGAGAGAGACCATAAGAAGTGTGRTCGACGGATACAGGACATCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26199
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021953 Essential Splice Site 325 810 11 22
Genomic Location (Zv9):
Chromosome 4 (position 2450037)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2648916
GRCz11 4 2579027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTCATCTCTGGCTGATGCGTGCCGTGTGTTTCTCTCTTTCTCTTATC[A/C]GGATGGGCAGCCTGACATCTTGCACACCTTCTGGAGTTCAGTCACTCAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26198
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021953 Essential Splice Site 564 810 16 22
Genomic Location (Zv9):
Chromosome 4 (position 2433340)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2632219
GRCz11 4 2562330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGCAGTTTTCCTCTAGCAGCAGAACAATCGCTCACAGCATCTTTAGAG[G/A]TAAAACTAAAAGAAATCAATCTAATGAGAATTAGACAGAAAGCACATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20180
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021953 Essential Splice Site 774 810 21 22
Genomic Location (Zv9):
Chromosome 4 (position 2421454)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2620333
GRCz11 4 2550444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGGTTGGATGACCATTCATCAGAGAAGGACCGTCTCACTCTTATTAG[G/A]TAAGTTCTGAGACTCAGAACTACAGTTTTATTTTGGCTGATTTCACAATA
Associated Phenotype:
Not determined