Busch Lab

ZMP

kcnk13a

Ensembl ID:
ENSDARG00000008212
ZFIN ID:
ZDB-GENE-080219-46
Description:
potassium channel, subfamily K, member 13 [Source:RefSeq peptide;Acc:NP_001103587]
Human Orthologue:
KCNK13
Human Description:
potassium channel, subfamily K, member 13 [Source:HGNC Symbol;Acc:6275]
Mouse Orthologue:
Kcnk13
Mouse Description:
potassium channel, subfamily K, member 13 Gene [Source:MGI Symbol;Acc:MGI:2384976]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7826
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017930 Nonsense 197 409 2 2
Genomic Location (Zv9):
Chromosome 17 (position 16178721)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16329549
GRCz11 17 16337482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCTAAACCATGAAGACAGTCTTGCAGGATGGAAGCCCTCGGTTTACTR[T/A]GTGATGCTGATCTTATGCRTGGCGGCAATAATCATTTCTTGCTGTGCTTC
Associated Phenotype:
Not determined