Busch Lab

ZMP

myt1la

Ensembl ID:
ENSDARG00000008209
ZFIN ID:
ZDB-GENE-041001-172
Description:
myelin transcription factor 1-like protein [Source:RefSeq peptide;Acc:NP_001038364]
Human Orthologue:
MYT1L
Human Description:
myelin transcription factor 1-like [Source:HGNC Symbol;Acc:7623]
Mouse Orthologue:
Myt1l
Mouse Description:
myelin transcription factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1100511]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11068 Essential Splice Site Available for shipment Available now
sa10388 Essential Splice Site Available for shipment Available now
sa23731 Nonsense Available for shipment Available now
sa37064 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11068
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Essential Splice Site 1 1257 None 22
ENSDART00000129169 None 1 1257 None 21
ENSDART00000131032 Essential Splice Site 1 539 None 7
Genomic Location (Zv9):
Chromosome 20 (position 30516588)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30587801
GRCz11 20 30490680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAGCTCAGCTAGTAGACTGAGGTCAGGCTAATTGCTGCTTCTTTTCTCC[A/T]GATGGAGGTGGATGCGGCAGAGAAGCGTCATCGAACACGATCTAAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10388
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Essential Splice Site 26 1257 3 22
ENSDART00000129169 Essential Splice Site 26 1257 2 21
ENSDART00000131032 Essential Splice Site 26 539 4 7
Genomic Location (Zv9):
Chromosome 20 (position 30516950)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30588163
GRCz11 20 30491042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTTCATTGTTTTGCAGTTGCCGTAGAGGCTGCACAGGAGCTATTCAGG[T/G]CAGTCTGCCTTTAATATTAGAATCATATTTTTACTKCAAAATACAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Nonsense 741 1257 11 22
ENSDART00000129169 Nonsense 741 1257 10 21
ENSDART00000131032 None None 539 None 7
Genomic Location (Zv9):
Chromosome 20 (position 30579008)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30650221
GRCz11 20 30553100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCGCTACTGTAAGACCTCGAGTCCGGCCAGCAGCACCACGAGCAGCTA[C/A]GCTCCCAGCAGCAGCAGCAGCCTGAGCTGTGGAGGAGGAGGAGGGGGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3061
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Nonsense 918 1257 13 22
ENSDART00000129169 Nonsense 918 1257 12 21
ENSDART00000131032 None None 539 None 7
Genomic Location (Zv9):
Chromosome 20 (position 30586820)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30658033
GRCz11 20 30560912
KASP Assay ID:
554-2733.1 (used for ordering genotyping assays)
KASP Sequence:
TAGAGGATCAGCAGTATTCAGGAGAAGTGTCTCTTCCCAGCCCCAAACAC[A/T]AATATGCTCCCTGCAAGGAGAGCAAGAAGGAGCTCCTCACGTAAGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37064
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Nonsense 1004 1257 17 22
ENSDART00000129169 Nonsense 1004 1257 16 21
ENSDART00000131032 None None 539 None 7
Genomic Location (Zv9):
Chromosome 20 (position 30591755)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30662968
GRCz11 20 30565847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTCTTTCTTGCTGAACTGGTCTCCGCTGTGCCCAATGTCTCCAGGTG[T/A]CCAGTGCCAGGCTGTGATGGCCAGGGTCACGTGACAGGGAAGTATGCCTC
Associated Phenotype:
Not determined