Busch Lab

ZMP

sf1

Ensembl ID:
ENSDARG00000008188
ZFIN ID:
ZDB-GENE-030131-2492
Description:
splicing factor 1 [Source:RefSeq peptide;Acc:NP_997818]
Mouse Orthologue:
Sf1
Mouse Description:
splicing factor 1 Gene [Source:MGI Symbol;Acc:MGI:1095403]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20917 Nonsense Available for shipment Available now
sa44657 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa40876 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020212 Nonsense 122 165 2 11
ENSDART00000126037 Nonsense 50 565 2 12
ENSDART00000143455 Nonsense 122 248 2 6

The following transcripts of ENSDARG00000008188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23978380)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22540132
GRCz11 7 22811289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCGGGCATGCCCACCGTGATCCCTCCTGGGCTGACTCGGGACCAAGAA[C/T]GAGCTTATATAGGTGAATATCTAAAATTTGCTATTACAACATCTGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44657
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020212 Nonsense 161 165 3 11
ENSDART00000126037 Missense 114 565 4 12
ENSDART00000143455 Missense 186 248 4 6

The following transcripts of ENSDARG00000008188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23983207)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22544959
GRCz11 7 22816116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATATCGCACGCGCAAGAAACTGGAAGAAGAGAGACATTCTCTCATTA[C/T]AGAGATGGTGGGACTGAACCCTGAATTCAAACCTCCAGCTGACTACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40876
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020212 None None 165 4 11
ENSDART00000126037 Nonsense 147 565 5 12
ENSDART00000143455 Nonsense 219 248 5 6

The following transcripts of ENSDARG00000008188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23983396)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22545148
GRCz11 7 22816305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCGGCAACACGGGTCAGTGATAAGGTGATGATTCCTCAGGATGAATA[T/A]CCAGAGATCAACTTTGTTGGGCTTTTAATTGGGCCACGGTGAGTAGTGTG
Associated Phenotype:
Not determined