Busch Lab

ZMP

rbl1

Ensembl ID:
ENSDARG00000008141
ZFIN ID:
ZDB-GENE-030131-8179
Description:
retinoblastoma-like protein 1 [Source:RefSeq peptide;Acc:NP_001124082]
Human Orthologue:
RBL1
Human Description:
retinoblastoma-like 1 (p107) [Source:HGNC Symbol;Acc:9893]
Mouse Orthologue:
Rbl1
Mouse Description:
retinoblastoma-like 1 (p107) Gene [Source:MGI Symbol;Acc:MGI:103300]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa7051 Nonsense Mutation detected in F1 DNA Not yet available
sa33967 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40792 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30879 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8648 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7051
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Nonsense 59 1058 2 22
Genomic Location (Zv9):
Chromosome 6 (position 51521789)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51570971
GRCz11 6 51570970
KASP Assay ID:
554-4253.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTGATCTGTAGGCTGTGTTTGGTTTTCTCAGGGTGATGTYATGCACTG[G/A]CTGGCCTGCTCTCTGTACGCTGCCTGTAGGAARAGCTCCATCCCTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33967
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 363 1058 9 22
Genomic Location (Zv9):
Chromosome 6 (position 51514868)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51564050
GRCz11 6 51564049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATATATATATATATATATATTTGCATCTTCTTCCTGTTTGTGTGCA[G/T]ACGCGTTCCCTTGCTCCCTCTACTCCTCTAACGGGTCGACGGTATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40792
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 536 1058 12 22
ENSDART00000073865 Essential Splice Site 536 1058 12 22
Genomic Location (Zv9):
Chromosome 6 (position 51513666)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51562848
GRCz11 6 51562847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGGATACTGGAAATCTTTCAGATCCCACCTTTCTACTTTTACAAG[G/A]TACAGAACATTGTCAGTATGGAGGATTAAACCTGCAAAAACAATACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 536 1058 12 22
ENSDART00000073865 Essential Splice Site 536 1058 12 22
Genomic Location (Zv9):
Chromosome 6 (position 51513666)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51562848
GRCz11 6 51562847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGGATACTGGAAATCTTTCAGATCCCACCTTTCTACTTTTACAAG[G/A]TACAGAACATTGTCAGTATGGAGGATTAAACCTGCAAAAACAATACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8648
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Nonsense 780 1058 17 22
Genomic Location (Zv9):
Chromosome 6 (position 51507226)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51556408
GRCz11 6 51556407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTCTTATTTCAAGTGCATATGTTCTGTTGCTRCTCCTTTCAGGTGTA[T/A]CATTTAGCCAGTGTGCGTCTGCGAGACCTGTGTCTGAAGCTGGATATCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3605
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 1003 1058 22 22
Genomic Location (Zv9):
Chromosome 6 (position 51500359)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51549541
GRCz11 6 51549540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GWTTTTTGGAGTTCTGRCTGTGGATCTAAAAGTTGACCTGTTTCTCTGCA[G/T]GAGCTGAGTGACATAAACCAGATGATYCGTCAGGGTGGCGTGAGCAAGAA
Associated Phenotype:
Not determined